Incidental Mutation 'R1103:Bud23'
ID98256
Institutional Source Beutler Lab
Gene Symbol Bud23
Ensembl Gene ENSMUSG00000005378
Gene NameBUD23, rRNA methyltransferase and ribosome maturation factor
Synonyms1110003N24Rik, Wbscr22
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135052957-135064959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135061139 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 67 (S67G)
Ref Sequence ENSEMBL: ENSMUSP00000083146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071263] [ENSMUST00000071677] [ENSMUST00000085984] [ENSMUST00000111205] [ENSMUST00000129691] [ENSMUST00000141309] [ENSMUST00000148549] [ENSMUST00000201554]
Predicted Effect probably benign
Transcript: ENSMUST00000071263
SMART Domains Protein: ENSMUSP00000094318
Gene: ENSMUSG00000061118

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
DnaJ 41 99 8.75e-19 SMART
low complexity region 123 141 N/A INTRINSIC
low complexity region 167 187 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071677
AA Change: S45G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071600
Gene: ENSMUSG00000005378
AA Change: S45G

DomainStartEndE-ValueType
Pfam:Methyltransf_11 36 120 4.7e-13 PFAM
Pfam:WBS_methylT 182 258 9.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085984
AA Change: S67G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083146
Gene: ENSMUSG00000005378
AA Change: S67G

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 143 5.3e-11 PFAM
Pfam:WBS_methylT 204 279 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111205
AA Change: S67G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106836
Gene: ENSMUSG00000005378
AA Change: S67G

DomainStartEndE-ValueType
Pfam:Methyltransf_11 58 142 1.1e-12 PFAM
Pfam:WBS_methylT 168 245 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129013
Predicted Effect probably benign
Transcript: ENSMUST00000129691
SMART Domains Protein: ENSMUSP00000120383
Gene: ENSMUSG00000005378

DomainStartEndE-ValueType
Pfam:WBS_methylT 88 138 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134180
Predicted Effect probably benign
Transcript: ENSMUST00000141309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147756
Predicted Effect probably damaging
Transcript: ENSMUST00000148549
AA Change: S36G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118370
Gene: ENSMUSG00000005378
AA Change: S36G

DomainStartEndE-ValueType
Pfam:Methyltransf_23 3 89 1.4e-8 PFAM
Pfam:Methyltransf_11 27 93 5.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151551
Predicted Effect probably benign
Transcript: ENSMUST00000201554
Predicted Effect probably benign
Transcript: ENSMUST00000202478
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a nuclear localization signal and an S-adenosyl-L-methionine binding motif typical of methyltransferases, suggesting that the encoded protein may act on DNA methylation. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Bud23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Bud23 APN 5 135061081 missense probably damaging 0.99
IGL03281:Bud23 APN 5 135063887 missense probably benign 0.01
R1765:Bud23 UTSW 5 135056043 missense probably benign 0.00
R3710:Bud23 UTSW 5 135056350 missense possibly damaging 0.54
R4486:Bud23 UTSW 5 135063925 unclassified probably null
R5109:Bud23 UTSW 5 135061023 intron probably benign
R5550:Bud23 UTSW 5 135063890 missense probably benign
R5614:Bud23 UTSW 5 135059112 missense probably benign 0.00
R5822:Bud23 UTSW 5 135063921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGGCATCTACATTGGAGGAAAAC -3'
(R):5'- TCCAGACCAAGATGACTGAGCGAG -3'

Sequencing Primer
(F):5'- caggtgtggtgggcagg -3'
(R):5'- TCCTCTGTTTACCAGAGGGT -3'
Posted On2014-01-05