Incidental Mutation 'R1103:Bag4'
ID98271
Institutional Source Beutler Lab
Gene Symbol Bag4
Ensembl Gene ENSMUSG00000037316
Gene NameBCL2-associated athanogene 4
Synonyms
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25764538-25785287 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 25767863 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038498]
Predicted Effect probably benign
Transcript: ENSMUST00000038498
SMART Domains Protein: ENSMUSP00000044725
Gene: ENSMUSG00000037316

DomainStartEndE-ValueType
low complexity region 5 49 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 276 301 N/A INTRINSIC
BAG 379 456 3.66e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210103
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant animals may show enhanced cytokine response and increased IL-6 production following TNF challenge. Studies on two different alleles of this gene are not in agreement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Bag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02054:Bag4 APN 8 25771225 missense probably benign
IGL02074:Bag4 APN 8 25769355 missense possibly damaging 0.87
IGL02129:Bag4 APN 8 25768085 missense probably damaging 1.00
IGL02183:Bag4 APN 8 25768030 missense probably damaging 1.00
IGL02441:Bag4 APN 8 25768108 missense probably damaging 1.00
R0414:Bag4 UTSW 8 25767997 missense possibly damaging 0.91
R1423:Bag4 UTSW 8 25768274 missense probably damaging 0.99
R1650:Bag4 UTSW 8 25777424 missense probably damaging 0.99
R2045:Bag4 UTSW 8 25769488 missense probably benign
R2333:Bag4 UTSW 8 25769488 missense probably benign
R2945:Bag4 UTSW 8 25771252 missense probably benign 0.08
R3124:Bag4 UTSW 8 25769488 missense probably benign
R3125:Bag4 UTSW 8 25769488 missense probably benign
R4428:Bag4 UTSW 8 25769488 missense probably benign
R4429:Bag4 UTSW 8 25769488 missense probably benign
R4431:Bag4 UTSW 8 25769488 missense probably benign
R4467:Bag4 UTSW 8 25769488 missense probably benign
R4482:Bag4 UTSW 8 25785044 unclassified probably benign
R4538:Bag4 UTSW 8 25769488 missense probably benign
R4539:Bag4 UTSW 8 25769488 missense probably benign
R4541:Bag4 UTSW 8 25769488 missense probably benign
R4542:Bag4 UTSW 8 25769488 missense probably benign
R4663:Bag4 UTSW 8 25769488 missense probably benign
R4708:Bag4 UTSW 8 25769488 missense probably benign
R4710:Bag4 UTSW 8 25769488 missense probably benign
R4732:Bag4 UTSW 8 25769488 missense probably benign
R4733:Bag4 UTSW 8 25769488 missense probably benign
R4970:Bag4 UTSW 8 25771244 nonsense probably null
R5175:Bag4 UTSW 8 25768351 missense probably damaging 0.99
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6032:Bag4 UTSW 8 25777493 missense probably damaging 1.00
R6084:Bag4 UTSW 8 25771231 missense probably benign 0.00
R6595:Bag4 UTSW 8 25769500 missense probably damaging 1.00
R6596:Bag4 UTSW 8 25769500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTGACAAGCAGCAGCCTACAG -3'
(R):5'- TTCAGATGAGGGCACTCCTCCAAG -3'

Sequencing Primer
(F):5'- GAGGTCTACTTGGCAATACTGAC -3'
(R):5'- CAGACAAAGCGTATTGGCTTC -3'
Posted On2014-01-05