Incidental Mutation 'R1103:Map3k5'
ID98280
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20023676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 226 (D226E)
Ref Sequence ENSEMBL: ENSMUSP00000112864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259] [ENSMUST00000129437] [ENSMUST00000152533]
Predicted Effect probably benign
Transcript: ENSMUST00000095806
AA Change: D234E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: D234E

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120259
AA Change: D226E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: D226E

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129437
SMART Domains Protein: ENSMUSP00000114518
Gene: ENSMUSG00000071369

DomainStartEndE-ValueType
Pfam:Pkinase 34 144 7.6e-20 PFAM
Pfam:Pkinase_Tyr 34 144 5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152533
AA Change: D72E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122553
Gene: ENSMUSG00000071369
AA Change: D72E

DomainStartEndE-ValueType
Pfam:DUF4071 10 80 6.3e-23 PFAM
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map1b A T 13: 99,427,466 probably benign Het
Map3k4 A T 17: 12,237,063 probably null Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGTCACTGTAACACGACCTGGCG -3'
(R):5'- GATTGGGGCCATTTGACTTGTGAAC -3'

Sequencing Primer
(F):5'- CACGACCTGGCGTTTTTTTTG -3'
(R):5'- CCCTGGCTCTTAAGTAGGAAC -3'
Posted On2014-01-05