Incidental Mutation 'R1103:Map1b'
ID98301
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Namemicrotubule-associated protein 1B
SynonymsMtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 039176-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1103 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location99421446-99516540 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 99427466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
Predicted Effect probably benign
Transcript: ENSMUST00000064762
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Meta Mutation Damage Score 0.1292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4930524J08Rik G A 5: 99,979,121 probably benign Het
4932438A13Rik A T 3: 36,996,523 M3003L probably benign Het
9530053A07Rik G T 7: 28,154,520 L1636F probably damaging Het
Adam3 T A 8: 24,714,271 probably benign Het
Adpgk A G 9: 59,313,796 H295R probably damaging Het
Aftph A T 11: 20,726,547 M199K probably benign Het
Ap2a1 C A 7: 44,904,169 probably benign Het
Atpaf2 T C 11: 60,403,950 I216V probably benign Het
Bag4 A T 8: 25,767,863 probably benign Het
Bud23 T C 5: 135,061,139 S67G probably damaging Het
Cfap157 A G 2: 32,781,398 F132S probably damaging Het
Cngb3 G A 4: 19,309,658 probably null Het
Cntnap5a A G 1: 116,580,669 I1304V possibly damaging Het
Cp A G 3: 19,981,985 K764E possibly damaging Het
Crebbp A G 16: 4,084,061 V2438A probably damaging Het
Csmd3 A T 15: 47,948,006 W1230R probably damaging Het
Cul1 G A 6: 47,517,177 V475I probably benign Het
Dnttip2 T C 3: 122,276,422 S429P probably benign Het
Dtwd1 T C 2: 126,154,723 S43P probably damaging Het
Ect2l T C 10: 18,140,526 T705A probably damaging Het
Erbin G T 13: 103,886,202 T43N probably benign Het
Flt4 C T 11: 49,636,339 probably benign Het
Gm13088 A C 4: 143,655,372 C251W probably damaging Het
Gpr150 G T 13: 76,055,593 P411Q probably damaging Het
Grap C A 11: 61,671,718 Q172K probably benign Het
Ido2 G A 8: 24,576,223 T9M probably benign Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Klra17 G A 6: 129,868,843 probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lhpp A T 7: 132,610,755 D17V probably damaging Het
Lrfn4 T C 19: 4,613,271 T412A probably benign Het
Lrrc7 C T 3: 158,148,706 probably benign Het
Ltbp3 A T 19: 5,747,411 probably null Het
Ltbp3 G C 19: 5,747,412 probably null Het
Luzp1 T A 4: 136,540,730 L88Q possibly damaging Het
Magi2 T C 5: 20,611,103 I747T probably damaging Het
Map3k4 A T 17: 12,237,063 probably null Het
Map3k5 C A 10: 20,023,676 D226E probably benign Het
Mtf1 T A 4: 124,838,468 S440T probably benign Het
Myo18a T A 11: 77,823,330 L389Q probably damaging Het
Myom2 A G 8: 15,110,827 D900G probably benign Het
Nfasc T C 1: 132,607,057 probably benign Het
Obscn A T 11: 59,021,483 S7044R probably damaging Het
Olfr1350 T A 7: 6,570,112 N40K probably damaging Het
Olfr424 T C 1: 174,136,891 V49A probably benign Het
Olfr513 T C 7: 108,754,883 V9A possibly damaging Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Sesn1 G T 10: 41,902,593 R346L possibly damaging Het
Setd4 G T 16: 93,585,194 H390Q probably benign Het
Supt6 T C 11: 78,225,473 E688G possibly damaging Het
Syne2 G A 12: 76,109,835 D6802N probably benign Het
Syt16 A G 12: 74,266,898 K533E probably damaging Het
Tg A T 15: 66,719,655 Q26H probably benign Het
Trim33 G T 3: 103,310,885 W250L probably damaging Het
Trip4 A G 9: 65,880,906 C86R probably benign Het
Upf2 T A 2: 6,026,175 C809S unknown Het
Vrk2 A G 11: 26,549,325 F76L probably damaging Het
Zfp804a A G 2: 82,257,500 T558A probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0539:Map1b UTSW 13 99434018 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCACAGGGACAAAGACGCCTATTTC -3'
(R):5'- TGTCTGCAAAGGGAAGCCAAGTC -3'

Sequencing Primer
(F):5'- GTTCAAATGCACCTCAGACATGG -3'
(R):5'- AGGGAAGCCAAGTCTTTTTCAG -3'
Posted On2014-01-05