Incidental Mutation 'R1104:Stau2'
ID98317
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 16440361 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 124 (Y124*)
Ref Sequence ENSEMBL: ENSMUSP00000124505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000127420] [ENSMUST00000128957] [ENSMUST00000131257] [ENSMUST00000149320] [ENSMUST00000151888] [ENSMUST00000153966] [ENSMUST00000159558] [ENSMUST00000162007] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect probably null
Transcript: ENSMUST00000027052
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000054668
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920
AA Change: Y124*

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000127420
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000122116
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-4 SMART
Blast:DSRM 5 42 9e-17 BLAST
Blast:DSRM 64 110 2e-25 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000128957
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000122410
Gene: ENSMUSG00000025920
AA Change: Y124*

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000131257
AA Change: Y86*
SMART Domains Protein: ENSMUSP00000121410
Gene: ENSMUSG00000025920
AA Change: Y86*

DomainStartEndE-ValueType
SCOP:d1di2a_ 1 34 9e-3 SMART
DSRM 58 142 2.36e-7 SMART
DSRM 170 235 1.84e-18 SMART
DSRM 270 336 5.45e-21 SMART
low complexity region 409 427 N/A INTRINSIC
PDB:4DKK|A 428 473 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000149320
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000118489
Gene: ENSMUSG00000025920
AA Change: Y124*

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000151888
AA Change: Y20*
SMART Domains Protein: ENSMUSP00000125473
Gene: ENSMUSG00000025920
AA Change: Y20*

DomainStartEndE-ValueType
Blast:DSRM 1 55 3e-35 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153966
SMART Domains Protein: ENSMUSP00000117537
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159558
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000125726
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000162007
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000124303
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000162435
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000162627
AA Change: Y92*
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920
AA Change: Y92*

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000162751
AA Change: Y124*
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920
AA Change: Y124*

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0124:Stau2 UTSW 1 16463128 missense probably damaging 1.00
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R2884:Stau2 UTSW 1 16231066 missense possibly damaging 0.81
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 intron probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R6964:Stau2 UTSW 1 16390005 missense probably damaging 1.00
R7317:Stau2 UTSW 1 16460329 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAACACACTTGGTGAGTCTGGTT -3'
(R):5'- AGGCATCTGGTGGCACATTGGT -3'

Sequencing Primer
(F):5'- GGTTTATCTAAACTCCCAAGATGCC -3'
(R):5'- GTCAAAGCATTACTGCTAACCCTG -3'
Posted On2014-01-05