Incidental Mutation 'R1104:Zfp12'
ID98351
Institutional Source Beutler Lab
Gene Symbol Zfp12
Ensembl Gene ENSMUSG00000029587
Gene Namezinc finger protein 12
SynonymsZfp-12, Krox-7
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143235163-143248834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143245745 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 609 (Y609C)
Ref Sequence ENSEMBL: ENSMUSP00000076693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032591] [ENSMUST00000075916] [ENSMUST00000077485] [ENSMUST00000161448]
Predicted Effect probably benign
Transcript: ENSMUST00000032591
AA Change: Y641C

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032591
Gene: ENSMUSG00000029587
AA Change: Y641C

DomainStartEndE-ValueType
KRAB 8 68 1.98e-36 SMART
low complexity region 188 199 N/A INTRINSIC
ZnF_C2H2 263 285 4.47e-3 SMART
ZnF_C2H2 291 313 2.43e-4 SMART
ZnF_C2H2 319 341 2.61e-4 SMART
ZnF_C2H2 347 369 1.04e-3 SMART
ZnF_C2H2 375 397 6.08e-5 SMART
ZnF_C2H2 403 425 2.99e-4 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 2.57e-3 SMART
ZnF_C2H2 487 509 6.32e-3 SMART
ZnF_C2H2 515 537 5.21e-4 SMART
ZnF_C2H2 543 565 9.44e-2 SMART
ZnF_C2H2 571 593 1.72e-4 SMART
ZnF_C2H2 599 621 2.86e-1 SMART
ZnF_C2H2 627 649 3.63e-3 SMART
ZnF_C2H2 655 677 4.54e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075916
SMART Domains Protein: ENSMUSP00000137971
Gene: ENSMUSG00000029587

DomainStartEndE-ValueType
KRAB 8 67 6.65e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077485
AA Change: Y609C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076693
Gene: ENSMUSG00000029587
AA Change: Y609C

DomainStartEndE-ValueType
KRAB 8 68 8.91e-21 SMART
low complexity region 156 167 N/A INTRINSIC
Pfam:zf-C2H2_6 183 200 8.8e-1 PFAM
ZnF_C2H2 231 253 4.47e-3 SMART
ZnF_C2H2 259 281 2.43e-4 SMART
ZnF_C2H2 287 309 2.61e-4 SMART
ZnF_C2H2 315 337 1.04e-3 SMART
ZnF_C2H2 343 365 6.08e-5 SMART
ZnF_C2H2 371 393 2.99e-4 SMART
ZnF_C2H2 399 421 9.08e-4 SMART
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 6.32e-3 SMART
ZnF_C2H2 483 505 5.21e-4 SMART
ZnF_C2H2 511 533 9.44e-2 SMART
ZnF_C2H2 539 561 1.72e-4 SMART
ZnF_C2H2 567 589 2.86e-1 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 4.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160195
Predicted Effect probably benign
Transcript: ENSMUST00000161448
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197349
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the krueppel C2H2-type zinc-finger protein family and encodes a protein with eight C2H2-type zinc fingers and a KRAB domain. This nuclear protein is involved in developmental control of gene expression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Krt40 T G 11: 99,540,233 E150A probably damaging Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Zfp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02471:Zfp12 APN 5 143244796 missense probably damaging 1.00
IGL02870:Zfp12 APN 5 143245331 missense probably damaging 0.99
IGL02975:Zfp12 APN 5 143244059 unclassified probably benign
R0362:Zfp12 UTSW 5 143245223 missense probably damaging 0.97
R0723:Zfp12 UTSW 5 143244883 missense probably damaging 1.00
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1403:Zfp12 UTSW 5 143244780 nonsense probably null
R1774:Zfp12 UTSW 5 143245229 missense probably damaging 1.00
R1895:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R1946:Zfp12 UTSW 5 143245378 missense probably damaging 1.00
R2280:Zfp12 UTSW 5 143245493 missense probably damaging 0.99
R3824:Zfp12 UTSW 5 143240322 missense probably benign 0.12
R4772:Zfp12 UTSW 5 143240000 missense probably damaging 1.00
R4786:Zfp12 UTSW 5 143245502 missense probably damaging 0.99
R5255:Zfp12 UTSW 5 143240379 missense probably null 0.08
R5496:Zfp12 UTSW 5 143244795 nonsense probably null
R5542:Zfp12 UTSW 5 143244485 missense possibly damaging 0.75
R5637:Zfp12 UTSW 5 143245696 missense probably damaging 1.00
R5742:Zfp12 UTSW 5 143245190 missense probably damaging 1.00
R5907:Zfp12 UTSW 5 143239988 missense probably damaging 1.00
R6701:Zfp12 UTSW 5 143244464 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AGGCTGTCGTACCTCACCGT -3'
(R):5'- TGTAAAGGAGCCGTCCCACATCAAT -3'

Sequencing Primer
(F):5'- acgagtgtaacgagtgtgg -3'
(R):5'- ATCAACCCCATTCCCGCTC -3'
Posted On2014-01-05