Incidental Mutation 'R1104:Krt40'
ID98385
Institutional Source Beutler Lab
Gene Symbol Krt40
Ensembl Gene ENSMUSG00000059169
Gene Namekeratin 40
SynonymsKa36
MMRRC Submission 039177-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R1104 (G1)
Quality Score206
Status Validated
Chromosome11
Chromosomal Location99537485-99543158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 99540233 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 150 (E150A)
Ref Sequence ENSEMBL: ENSMUSP00000103067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074253] [ENSMUST00000107443]
Predicted Effect probably damaging
Transcript: ENSMUST00000074253
AA Change: E230A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073869
Gene: ENSMUSG00000059169
AA Change: E230A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Filament 88 399 1.07e-139 SMART
internal_repeat_1 409 419 9.76e-5 PROSPERO
internal_repeat_1 417 427 9.76e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000107443
AA Change: E150A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103067
Gene: ENSMUSG00000059169
AA Change: E150A

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Filament 88 149 4.8e-19 PFAM
Pfam:Filament 146 319 6.1e-50 PFAM
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
4430402I18Rik T C 19: 28,967,632 M1V probably null Het
4930550C14Rik A G 9: 53,421,617 I93V probably benign Het
Abcg5 A C 17: 84,682,049 I77S possibly damaging Het
Adam3 T C 8: 24,681,529 Y762C probably benign Het
Agap1 T C 1: 89,789,240 S26P probably damaging Het
Ago1 T C 4: 126,453,633 Y441C probably damaging Het
B3gnt3 A G 8: 71,693,837 L16S possibly damaging Het
Btaf1 T A 19: 37,004,602 D1677E probably damaging Het
Cd5l T A 3: 87,360,899 S18T probably benign Het
Cdca2 T A 14: 67,693,682 R521W probably damaging Het
Cfap61 C A 2: 145,951,061 S64* probably null Het
Cryzl2 T A 1: 157,470,604 probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dhrs1 T C 14: 55,743,705 K83E probably benign Het
Dmrt2 T A 19: 25,678,616 F526L probably benign Het
Dnajb14 T A 3: 137,908,354 M342K possibly damaging Het
Dpf3 A G 12: 83,331,987 V101A probably benign Het
Dthd1 A C 5: 62,821,959 T321P probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fras1 G A 5: 96,708,671 R1971Q probably benign Het
Fry A G 5: 150,496,289 N608S probably damaging Het
Gabrr3 T A 16: 59,461,635 V451D probably damaging Het
Glg1 A G 8: 111,197,603 L251P probably benign Het
Gli2 T A 1: 118,853,350 S222C probably damaging Het
Gm340 G T 19: 41,586,063 G1086C probably damaging Het
Gsr A G 8: 33,669,921 E99G probably damaging Het
Hist1h1b T C 13: 21,780,281 T92A possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hus1b T C 13: 30,947,696 probably benign Het
Igf1r T A 7: 68,195,026 I849N possibly damaging Het
Itih5 A G 2: 10,251,512 T930A probably benign Het
Ivns1abp T A 1: 151,360,109 M309K probably benign Het
Kdm3b T A 18: 34,819,811 F1078Y probably damaging Het
Krt12 C A 11: 99,421,966 G84V unknown Het
Lcn11 G T 2: 25,779,103 probably benign Het
Liph A G 16: 21,984,148 I57T possibly damaging Het
Lrrc46 C T 11: 97,036,171 V107M probably damaging Het
Ltb4r1 T C 14: 55,767,375 I45T probably damaging Het
Mapkbp1 A G 2: 120,011,073 probably benign Het
Mark3 C T 12: 111,618,397 probably benign Het
Mug2 C T 6: 122,059,055 A642V probably benign Het
Myh11 A G 16: 14,202,127 S1814P possibly damaging Het
Ndst1 T A 18: 60,697,146 S631C probably damaging Het
Nrbf2 A T 10: 67,267,912 D137E possibly damaging Het
Olfr630 A G 7: 103,754,976 V203A probably benign Het
Olfr698 A T 7: 106,752,782 M202K probably benign Het
Olfr784 T A 10: 129,388,221 M196K probably benign Het
Parn A G 16: 13,667,585 Y16H probably damaging Het
Parp14 A G 16: 35,844,415 probably benign Het
Prl3d1 C T 13: 27,100,009 T187I probably benign Het
Ptgir G A 7: 16,907,130 probably null Het
Rabgap1l C T 1: 160,231,875 probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Rnf213 T C 11: 119,477,229 Y4697H probably benign Het
Rps6ka4 T A 19: 6,830,996 I598F probably damaging Het
Ryr2 C T 13: 11,669,969 V3029M probably damaging Het
Slc17a2 T C 13: 23,819,937 F335S probably damaging Het
Stau2 A T 1: 16,440,361 Y124* probably null Het
Tbl3 A G 17: 24,701,606 I652T probably benign Het
Trappc3 C T 4: 126,272,966 probably benign Het
Trim60 A T 8: 65,001,419 F59L probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,916,256 F4686S probably benign Het
Vcan T C 13: 89,692,410 T1672A probably damaging Het
Vmn1r215 T A 13: 23,076,588 I266N possibly damaging Het
Vmn2r6 A T 3: 64,538,066 V657E possibly damaging Het
Wdr95 G T 5: 149,606,337 A548S probably benign Het
Zfp12 A G 5: 143,245,745 Y609C probably damaging Het
Znfx1 C A 2: 167,055,640 E455* probably null Het
Other mutations in Krt40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Krt40 APN 11 99541219 missense probably damaging 1.00
IGL01483:Krt40 APN 11 99542727 missense probably damaging 1.00
IGL01621:Krt40 APN 11 99542868 missense probably damaging 1.00
IGL01921:Krt40 APN 11 99543163 unclassified probably benign
IGL02095:Krt40 APN 11 99541671 missense probably damaging 0.98
IGL02735:Krt40 APN 11 99538635 missense probably damaging 1.00
IGL02960:Krt40 APN 11 99539867 splice site probably null
IGL02965:Krt40 APN 11 99541666 missense probably damaging 1.00
IGL03168:Krt40 APN 11 99543028 missense possibly damaging 0.87
IGL03240:Krt40 APN 11 99537568 missense probably damaging 1.00
IGL03387:Krt40 APN 11 99539885 missense probably damaging 1.00
R0178:Krt40 UTSW 11 99541739 missense probably damaging 0.99
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0242:Krt40 UTSW 11 99538742 missense probably damaging 1.00
R0389:Krt40 UTSW 11 99541714 nonsense probably null
R2018:Krt40 UTSW 11 99540087 missense probably damaging 1.00
R2022:Krt40 UTSW 11 99539992 missense probably damaging 1.00
R4498:Krt40 UTSW 11 99543074 missense possibly damaging 0.53
R4716:Krt40 UTSW 11 99540219 missense probably damaging 1.00
R5886:Krt40 UTSW 11 99540081 missense probably benign 0.34
R6232:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6233:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6235:Krt40 UTSW 11 99543094 missense possibly damaging 0.85
R6248:Krt40 UTSW 11 99541740 missense possibly damaging 0.95
R7064:Krt40 UTSW 11 99540128 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGAAACAAAGGCCCCATTAGAGAGC -3'
(R):5'- GGAGCCCACAACTGTCCATAACTG -3'

Sequencing Primer
(F):5'- GAAGCCAGTCCTTTACCGAG -3'
(R):5'- TGTGGCATACAGGCACAC -3'
Posted On2014-01-05