Mutagenetix > Incidental Mutation

Incidental Mutation 'R1106:Vps37a'

98477

Institutional Source

Beutler Lab

Gene Symbol

Vps37a

Ensembl Gene

ENSMUSG00000031600

Gene Name

vacuolar protein sorting 37A

Synonyms

4930592A21Rik, D8Ertd531e, 2210018P21Rik

MMRRC Submission

039179-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.353) question?

Stock #

R1106 (G1)

Quality Score

135

Status

Not validated

Chromosome

Chromosomal Location

40964824-41003798 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40965247 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 33 (I33N)

Ref Sequence

ENSEMBL: ENSMUSP00000096415 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000149992] [ENSMUST00000135269]

AlphaFold

Q8CHS8

Predicted Effect

probably benign
Transcript: ENSMUST00000034012

SMART Domains

Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601

Domain	Start	End	E-Value	Type
Pfam:CAF1	15	139	9.1e-15	PFAM
Pfam:CAF1	132	238	1.2e-14	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098817
AA Change: I33N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600
AA Change: I33N

Domain	Start	End	E-Value	Type
low complexity region	6	22	N/A	INTRINSIC
Blast:UBCc	29	128	6e-6	BLAST
low complexity region	155	164	N/A	INTRINSIC
low complexity region	171	189	N/A	INTRINSIC
Pfam:Mod_r	235	380	2.7e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128166

SMART Domains

Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

Domain	Start	End	E-Value	Type
transmembrane domain	16	38	N/A	INTRINSIC
transmembrane domain	48	70	N/A	INTRINSIC
Pfam:zf-DHHC	122	248	1.8e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128237

Predicted Effect

probably benign
Transcript: ENSMUST00000132032

SMART Domains

Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132200

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132740

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139558

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146280

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144970

Predicted Effect

probably benign
Transcript: ENSMUST00000149992

SMART Domains

Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	240	3.4e-73	PFAM
low complexity region	259	268	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135269

SMART Domains

Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601

Domain	Start	End	E-Value	Type
Pfam:CAF1	13	245	7e-66	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the VPS37 family, and encodes a component of the ESCRT-I (endosomal sorting complex required for transport I) protein complex, required for the sorting of ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies. Expression of this gene is downregulated in hepatocellular carcinoma, and mutations in this gene are associated with autosomal recessive spastic paraplegia-53. A related pseudogene has been identified on chromosome 5. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic5	C	A	3: 81,911,897 (GRCm39)	F122L	probably damaging	Het
Caml	A	G	13: 55,772,538 (GRCm39)	T61A	probably benign	Het
Cfap20	A	T	8: 96,147,873 (GRCm39)	I156N	probably damaging	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Dio2	A	G	12: 90,704,985 (GRCm39)	L25P	probably damaging	Het
Eps8	G	A	6: 137,491,322 (GRCm39)	P352L	probably damaging	Het
Gnai2	A	G	9: 107,497,385 (GRCm39)	I3T	probably damaging	Het
Hexim2	T	C	11: 103,029,319 (GRCm39)	S124P	probably damaging	Het
Klk1b16	C	T	7: 43,788,937 (GRCm39)	R57C	probably damaging	Het
Mier3	A	T	13: 111,844,763 (GRCm39)	D205V	probably damaging	Het
Or2y14	A	G	11: 49,404,519 (GRCm39)	D18G	probably damaging	Het
Or4c102	T	C	2: 88,422,355 (GRCm39)	V69A	probably benign	Het
Ptprz1	A	G	6: 22,965,748 (GRCm39)	D192G	probably damaging	Het
Samd3	G	A	10: 26,147,689 (GRCm39)	V455M	possibly damaging	Het
Slc9c1	C	A	16: 45,376,170 (GRCm39)	Q419K	possibly damaging	Het
Syce1	C	A	7: 140,359,809 (GRCm39)	L83F	probably damaging	Het
Tas2r139	A	G	6: 42,118,479 (GRCm39)	T204A	probably benign	Het
Ush2a	G	A	1: 188,643,180 (GRCm39)	E4181K	possibly damaging	Het
Zfp335	TTGCTGCTGCTGCTGCTGCT	TTGCTGCTGCTGCTGCT	2: 164,749,471 (GRCm39)		probably benign	Het
Zik1	G	A	7: 10,224,312 (GRCm39)	R262C	probably damaging	Het

Other mutations in Vps37a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Vps37a	APN	8	40,993,779 (GRCm39)	missense	probably benign	0.00
IGL01963:Vps37a	APN	8	40,993,771 (GRCm39)	missense	probably damaging	0.99
PIT4377001:Vps37a	UTSW	8	40,990,087 (GRCm39)	missense	possibly damaging	0.71
R0090:Vps37a	UTSW	8	40,980,030 (GRCm39)	missense	possibly damaging	0.92
R1815:Vps37a	UTSW	8	40,965,162 (GRCm39)	missense	probably benign
R3612:Vps37a	UTSW	8	40,997,977 (GRCm39)	splice site	probably benign
R5775:Vps37a	UTSW	8	40,982,160 (GRCm39)	missense	probably damaging	1.00
R5948:Vps37a	UTSW	8	40,993,752 (GRCm39)	missense	possibly damaging	0.64
R6048:Vps37a	UTSW	8	40,981,363 (GRCm39)	missense	probably damaging	1.00
R6337:Vps37a	UTSW	8	40,993,749 (GRCm39)	missense	probably benign	0.10
R6715:Vps37a	UTSW	8	40,993,902 (GRCm39)	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGCAGGCCAGAACCTTGTAG -3'
(R):5'- CTGGCAAGTCCTAAGTGTGGAGC -3'

Sequencing Primer
(F):5'- AGGATGAGCTGGCTCTTTCC -3'
(R):5'- TTCGAAGGCAATGCTACAATCAG -3'

Posted On

2014-01-05