Incidental Mutation 'R1106:Caml'
ID98492
Institutional Source Beutler Lab
Gene Symbol Caml
Ensembl Gene ENSMUSG00000021501
Gene Namecalcium modulating ligand
Synonyms
MMRRC Submission 039179-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1106 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55623005-55632411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55624725 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 61 (T61A)
Ref Sequence ENSEMBL: ENSMUSP00000021963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021963]
Predicted Effect probably benign
Transcript: ENSMUST00000021963
AA Change: T61A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000021963
Gene: ENSMUSG00000021501
AA Change: T61A

DomainStartEndE-ValueType
Pfam:CAML 21 290 8.8e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169228
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both functional copies of this gene die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic5 C A 3: 82,004,590 F122L probably damaging Het
Cfap20 A T 8: 95,421,245 I156N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dio2 A G 12: 90,738,211 L25P probably damaging Het
Eps8 G A 6: 137,514,324 P352L probably damaging Het
Gnai2 A G 9: 107,620,186 I3T probably damaging Het
Hexim2 T C 11: 103,138,493 S124P probably damaging Het
Klk1b16 C T 7: 44,139,513 R57C probably damaging Het
Mier3 A T 13: 111,708,229 D205V probably damaging Het
Olfr1189 T C 2: 88,592,011 V69A probably benign Het
Olfr1384 A G 11: 49,513,692 D18G probably damaging Het
Ptprz1 A G 6: 22,965,749 D192G probably damaging Het
Samd3 G A 10: 26,271,791 V455M possibly damaging Het
Slc9c1 C A 16: 45,555,807 Q419K possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tas2r139 A G 6: 42,141,545 T204A probably benign Het
Ush2a G A 1: 188,910,983 E4181K possibly damaging Het
Vps37a T A 8: 40,512,206 I33N probably damaging Het
Zfp335 TTGCTGCTGCTGCTGCTGCT TTGCTGCTGCTGCTGCT 2: 164,907,551 probably benign Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Caml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Caml APN 13 55628577 missense probably damaging 1.00
IGL02961:Caml APN 13 55631882 missense probably benign 0.08
H8786:Caml UTSW 13 55628596 missense probably damaging 1.00
R0542:Caml UTSW 13 55623161 missense possibly damaging 0.94
R0673:Caml UTSW 13 55631828 missense probably damaging 1.00
R1171:Caml UTSW 13 55625007 missense probably damaging 1.00
R1661:Caml UTSW 13 55631971 missense probably benign 0.12
R1665:Caml UTSW 13 55631971 missense probably benign 0.12
R4613:Caml UTSW 13 55625142 missense probably damaging 0.99
R4774:Caml UTSW 13 55631927 missense possibly damaging 0.96
R5945:Caml UTSW 13 55628632 missense probably damaging 1.00
R6247:Caml UTSW 13 55625173 critical splice donor site probably null
R6433:Caml UTSW 13 55623249 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCCTTGGGACATCCCGTGCTAAC -3'
(R):5'- GAATGAGTCCAGTTTGTCTCCCAGC -3'

Sequencing Primer
(F):5'- ACATCCCGTGCTAACTTTGGTAG -3'
(R):5'- AGCTGGGTTCCCCTGAC -3'
Posted On2014-01-05