Incidental Mutation 'R1107:Apba2'
ID98514
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 2
SynonymsX11L, X11-like, Mint 2
MMRRC Submission 039180-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R1107 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location64501706-64753878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64745719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 636 (V636I)
Ref Sequence ENSEMBL: ENSMUSP00000146038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032732
AA Change: V648I

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: V648I

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206061
Predicted Effect possibly damaging
Transcript: ENSMUST00000206246
AA Change: V636I

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000206630
AA Change: V23I
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 T C 6: 39,585,785 V530A possibly damaging Het
Cacna1b G A 2: 24,697,603 A625V probably damaging Het
Ccdc134 C A 15: 82,134,691 R141S possibly damaging Het
Ccdc134 T A 15: 82,134,694 W142R probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Dlg1 A G 16: 31,846,916 E697G probably benign Het
Fam208a C T 14: 27,479,723 Q49* probably null Het
Fezf2 A T 14: 12,342,624 C414S probably damaging Het
Kif26b A C 1: 178,917,673 N1778T probably benign Het
Lrp1 T C 10: 127,557,435 Y2683C probably damaging Het
Mroh7 T C 4: 106,707,594 probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pclo T A 5: 14,677,869 probably benign Het
Rnf220 C A 4: 117,285,390 G114V probably damaging Het
Zik1 G A 7: 10,490,385 R262C probably damaging Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64736941 missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64745826 splice site probably benign
IGL02218:Apba2 APN 7 64695677 missense probably benign 0.01
IGL02343:Apba2 APN 7 64695146 missense probably damaging 0.96
IGL03265:Apba2 APN 7 64695323 missense probably damaging 1.00
guadalupe UTSW 7 64750164 missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64622160 intron probably benign
R0395:Apba2 UTSW 7 64743408 missense probably benign 0.00
R0554:Apba2 UTSW 7 64745780 missense probably damaging 1.00
R0624:Apba2 UTSW 7 64714515 splice site probably null
R0733:Apba2 UTSW 7 64750164 missense probably damaging 1.00
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1486:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R1895:Apba2 UTSW 7 64744630 critical splice donor site probably null
R1942:Apba2 UTSW 7 64695470 missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64744630 critical splice donor site probably null
R2002:Apba2 UTSW 7 64733542 missense probably damaging 0.97
R2089:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2571:Apba2 UTSW 7 64745750 missense probably damaging 0.98
R3035:Apba2 UTSW 7 64739792 missense probably benign 0.03
R4620:Apba2 UTSW 7 64714467 missense probably damaging 1.00
R5468:Apba2 UTSW 7 64745762 missense probably damaging 1.00
R5478:Apba2 UTSW 7 64695186 nonsense probably null
R5644:Apba2 UTSW 7 64715511 missense probably benign
R5645:Apba2 UTSW 7 64695806 missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64745716 missense probably benign 0.03
R5969:Apba2 UTSW 7 64744447 nonsense probably null
R6190:Apba2 UTSW 7 64739880 missense probably damaging 0.98
R6806:Apba2 UTSW 7 64695459 missense probably damaging 1.00
R7098:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R7143:Apba2 UTSW 7 64744417 missense probably damaging 1.00
R7183:Apba2 UTSW 7 64733545 missense probably benign 0.11
R7260:Apba2 UTSW 7 64739745 missense probably damaging 1.00
R7479:Apba2 UTSW 7 64739859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGCAACTCCTCAGGTTCTCACAG -3'
(R):5'- TAGTCCCCAAGGGAAGACGCTATG -3'

Sequencing Primer
(F):5'- CTCAGGTTCTCACAGAGCAG -3'
(R):5'- TCTCCATAGGCAGAGTAGCAC -3'
Posted On2014-01-05