Incidental Mutation 'R1109:Fasn'
ID98676
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1109 (G1)
Quality Score123
Status Validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120812324 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1625 (F1625S)
Ref Sequence ENSEMBL: ENSMUSP00000052872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000206589]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055655
AA Change: F1625S

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: F1625S

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155276
Predicted Effect probably benign
Transcript: ENSMUST00000206589
AA Change: F1623S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206637
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Safb T A 17: 56,601,228 probably benign Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0389:Fasn UTSW 11 120816182 missense probably damaging 1.00
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 unclassified probably null
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCGCGAACCACTAACGAGTAGTAAG -3'
(R):5'- AGCGAGAAGGAAGTTGTCCTGCAC -3'

Sequencing Primer
(F):5'- TAGTAAGCAGTGGTATAGACGAC -3'
(R):5'- CTGACAACCTGTCCTAGAGTG -3'
Posted On2014-01-05