Incidental Mutation 'R1109:Safb'
ID98695
Institutional Source Beutler Lab
Gene Symbol Safb
Ensembl Gene ENSMUSG00000071054
Gene Namescaffold attachment factor B
Synonyms3110021E02Rik, SAFB1, 5330423C17Rik
MMRRC Submission 039182-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R1109 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location56584825-56606294 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 56601228 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000095224] [ENSMUST00000182533]
Predicted Effect unknown
Transcript: ENSMUST00000095224
AA Change: S532T
SMART Domains Protein: ENSMUSP00000092849
Gene: ENSMUSG00000071054
AA Change: S532T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182461
Predicted Effect unknown
Transcript: ENSMUST00000182533
AA Change: S532T
SMART Domains Protein: ENSMUSP00000138277
Gene: ENSMUSG00000071054
AA Change: S532T

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SAP 31 65 7.15e-11 SMART
coiled coil region 268 291 N/A INTRINSIC
low complexity region 292 300 N/A INTRINSIC
RRM 429 502 3.76e-19 SMART
coiled coil region 651 728 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
low complexity region 887 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182913
Predicted Effect probably benign
Transcript: ENSMUST00000182951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183318
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.9%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein which has high specificity for scaffold or matrix attachment region DNA elements (S/MAR DNA). This protein is thought to be involved in attaching the base of chromatin loops to the nuclear matrix but there is conflicting evidence as to whether this protein is a component of chromatin or a nuclear matrix protein. Scaffold attachment factors are a specific subset of nuclear matrix proteins (NMP) that specifically bind to S/MAR. The encoded protein is thought to serve as a molecular base to assemble a 'transcriptosome complex' in the vicinity of actively transcribed genes. It is involved in the regulation of heat shock protein 27 transcription, can act as an estrogen receptor co-repressor and is a candidate for breast tumorigenesis. This gene is arranged head-to-head with a similar gene whose product has the same functions. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and neonatal lethality, neonatal cyanosis, impaired embryonic hematopoiesis, male sterility, azoospermia, reduced female fertility, impaired transport of embryos through the oviduct, reduced embryonic growth, testicular degeneration and ovarian atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,775,329 I351F probably damaging Het
Abcd3 T G 3: 121,779,596 E262D probably damaging Het
Abcg1 G A 17: 31,111,236 A504T probably benign Het
Acot11 T C 4: 106,749,348 T515A probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Arhgap44 T A 11: 65,026,816 H375L probably benign Het
Aspm A T 1: 139,456,758 I98F probably damaging Het
Atp8b5 T C 4: 43,305,719 probably benign Het
Ccdc129 G T 6: 55,968,260 K655N probably damaging Het
Coa3 T C 11: 101,278,785 K48R probably damaging Het
Col12a1 A G 9: 79,699,723 S473P probably damaging Het
Dnmt1 A T 9: 20,922,388 Y451N probably damaging Het
Dock5 A G 14: 67,806,478 Y819H possibly damaging Het
Dtx1 G A 5: 120,710,419 probably benign Het
Dus2 T A 8: 106,053,482 F479I probably benign Het
Esrp1 T C 4: 11,365,205 E262G probably damaging Het
Exoc4 A G 6: 33,442,016 Y466C probably damaging Het
Fasn A G 11: 120,812,324 F1625S possibly damaging Het
Fbxw25 A T 9: 109,650,060 H374Q probably benign Het
Focad T C 4: 88,196,747 probably benign Het
Gad2 G T 2: 22,681,394 R448L probably damaging Het
Gad2 G A 2: 22,690,159 probably benign Het
Galnt16 G T 12: 80,590,631 E377D probably benign Het
Gcc1 A C 6: 28,419,167 L389R probably damaging Het
Ggct A T 6: 54,989,569 probably benign Het
Gm7052 G A 17: 22,040,152 probably benign Het
Gps2 T A 11: 69,915,681 H177Q possibly damaging Het
Heg1 T A 16: 33,763,591 L1256Q probably damaging Het
Ikbkap T C 4: 56,786,723 T407A probably benign Het
Il1f6 G A 2: 24,216,590 G62E probably damaging Het
Il3ra C T 14: 14,349,317 R138W probably damaging Het
Kdm4b T A 17: 56,399,430 I848N probably damaging Het
L3hypdh A G 12: 72,073,996 V327A possibly damaging Het
Lepr G T 4: 101,771,355 L552F probably damaging Het
Lpin3 T C 2: 160,899,021 I449T probably damaging Het
Lrrn1 A G 6: 107,567,264 K8E probably benign Het
Mex3a G T 3: 88,536,660 D348Y possibly damaging Het
Mindy2 G A 9: 70,631,079 R325* probably null Het
Mkrn1 A T 6: 39,399,334 M382K probably damaging Het
Mroh1 G T 15: 76,446,509 probably benign Het
Myo15 T A 11: 60,493,066 D1646E probably damaging Het
Neu2 A G 1: 87,596,728 D145G probably damaging Het
Olfr317 T C 11: 58,732,916 Y83C probably benign Het
Olfr718-ps1 A T 5: 143,137,619 N216K probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Plekhm2 T A 4: 141,627,984 I938F probably benign Het
Pnmal1 A T 7: 16,961,467 K416* probably null Het
Ppid T C 3: 79,598,861 S198P probably benign Het
Rabl6 G T 2: 25,587,526 P304Q probably damaging Het
Rasal2 A T 1: 157,177,638 probably benign Het
Ripor1 G T 8: 105,618,928 probably benign Het
Rnf216 A T 5: 143,068,369 L658Q probably damaging Het
Rnf219 A T 14: 104,479,764 L391* probably null Het
Sf3b5 T C 10: 13,008,753 M44T probably benign Het
Slc26a9 A T 1: 131,758,798 M419L probably benign Het
Slc38a8 T C 8: 119,482,655 D393G probably benign Het
Slc6a3 A G 13: 73,557,080 D230G probably benign Het
Smc1b T C 15: 85,112,815 T535A probably damaging Het
Smg7 G C 1: 152,845,583 P626R probably damaging Het
Smu1 C T 4: 40,755,722 V48M probably benign Het
Spag17 T C 3: 100,027,351 Y650H possibly damaging Het
Spata1 C T 3: 146,475,298 V302I possibly damaging Het
Sptb G A 12: 76,603,603 A1780V probably damaging Het
Srrm2 G A 17: 23,819,617 probably benign Het
Sspo A C 6: 48,497,443 N4933H probably damaging Het
Sult2a2 T C 7: 13,734,873 I88T probably benign Het
Tgfa G T 6: 86,270,090 probably benign Het
Thsd1 T A 8: 22,243,692 C252S possibly damaging Het
Tmem102 T A 11: 69,804,804 H114L probably damaging Het
Tnni3k T A 3: 154,792,777 K808N possibly damaging Het
Trpm7 G T 2: 126,797,793 L1628M probably benign Het
Ttn A G 2: 76,730,737 Y29107H probably damaging Het
Upb1 T C 10: 75,438,165 L342P probably damaging Het
Vmn2r120 T C 17: 57,525,829 T117A probably benign Het
Vmn2r16 A G 5: 109,339,786 D175G probably damaging Het
Zfhx4 T G 3: 5,399,870 M1696R possibly damaging Het
Zfp746 A G 6: 48,064,922 V289A possibly damaging Het
Zfyve26 A C 12: 79,272,127 F1146V probably damaging Het
Other mutations in Safb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Safb APN 17 56602974 unclassified probably benign
IGL02391:Safb APN 17 56600813 splice site probably benign
IGL03145:Safb APN 17 56605287 missense probably damaging 1.00
R0245:Safb UTSW 17 56606025 missense probably damaging 1.00
R0464:Safb UTSW 17 56606025 missense probably damaging 1.00
R0468:Safb UTSW 17 56606025 missense probably damaging 1.00
R0479:Safb UTSW 17 56606025 missense probably damaging 1.00
R0496:Safb UTSW 17 56605630 missense probably benign 0.05
R0639:Safb UTSW 17 56601092 utr 3 prime probably benign
R0655:Safb UTSW 17 56597803 missense probably benign 0.23
R1941:Safb UTSW 17 56598992 intron probably benign
R1969:Safb UTSW 17 56605821 missense probably benign 0.32
R1971:Safb UTSW 17 56605821 missense probably benign 0.32
R4010:Safb UTSW 17 56603765 unclassified probably benign
R4132:Safb UTSW 17 56600848 utr 3 prime probably benign
R5429:Safb UTSW 17 56588822 missense probably benign 0.15
R5681:Safb UTSW 17 56599000 intron probably benign
R5900:Safb UTSW 17 56600349 missense unknown
R6077:Safb UTSW 17 56602956 unclassified probably benign
R6173:Safb UTSW 17 56597798 missense probably damaging 1.00
R6367:Safb UTSW 17 56593845 unclassified probably benign
R6735:Safb UTSW 17 56585169 unclassified probably benign
R6736:Safb UTSW 17 56606023 missense possibly damaging 0.46
X0065:Safb UTSW 17 56603798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGGCAAGATGATCTCAGTGG -3'
(R):5'- TGATGACAGGCACACCTTTGGAC -3'

Sequencing Primer
(F):5'- ATGATGGCACTAGCTTTTGACTC -3'
(R):5'- ACGGCTTCCTGTAAGCAGAG -3'
Posted On2014-01-05