Incidental Mutation 'R0089:Slc22a30'
ID98714
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 038376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0089 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8370197 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 280 (S280T)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
AA Change: S280T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: S280T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
AA Change: S280T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: S280T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120540
AA Change: S280T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: S280T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 98% (82/84)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,292,886 V1583E possibly damaging Het
Ablim1 G T 19: 57,043,031 S654Y probably damaging Het
Acbd4 T C 11: 103,103,993 F59S probably damaging Het
Acot1 T C 12: 84,016,934 I272T probably damaging Het
Ankhd1 A G 18: 36,640,356 D1402G probably damaging Het
Birc6 T A 17: 74,638,376 F2800I possibly damaging Het
Brd1 T C 15: 88,701,198 E811G probably benign Het
Ccdc106 A G 7: 5,056,221 probably null Het
Ccdc81 G T 7: 89,893,116 A184E possibly damaging Het
Cenpt T C 8: 105,846,368 T364A probably benign Het
Crybg2 T C 4: 134,081,194 S1060P probably damaging Het
Dnttip2 A G 3: 122,275,462 T109A possibly damaging Het
Dpy19l2 A G 9: 24,695,793 L124P probably benign Het
Fat3 T C 9: 15,938,205 D3967G probably benign Het
Fbxo21 T A 5: 118,008,143 F610L probably benign Het
Fmo9 T C 1: 166,667,309 D341G probably benign Het
Frem3 A T 8: 80,615,878 H1600L possibly damaging Het
Fry A T 5: 150,340,427 K133N possibly damaging Het
Gm10647 A G 9: 66,798,330 probably benign Het
Gm13124 T A 4: 144,555,733 H163L probably benign Het
Gm16432 C T 1: 178,046,989 P141S unknown Het
Gm21319 A T 12: 87,773,513 I92N probably damaging Het
Gmps T C 3: 63,998,698 F472S probably benign Het
Grb10 T C 11: 11,934,192 probably benign Het
Grm6 G A 11: 50,859,965 G652S probably damaging Het
Heca G T 10: 17,908,100 D468E probably damaging Het
Heg1 C T 16: 33,763,615 S1033L probably damaging Het
Hepacam2 A G 6: 3,487,094 S12P probably damaging Het
Impdh1 G T 6: 29,206,326 H195N probably benign Het
Ipo7 T C 7: 110,050,765 probably benign Het
Itpr2 C T 6: 146,350,022 probably null Het
Kcnh6 G A 11: 106,009,022 C39Y probably benign Het
Kif26a T C 12: 112,177,403 S1364P probably damaging Het
Lins1 T A 7: 66,712,048 probably benign Het
Lrpap1 C T 5: 35,094,888 V328M possibly damaging Het
Lyn T G 4: 3,748,768 L249V probably benign Het
Mpp7 A G 18: 7,439,555 probably benign Het
Mtmr9 A G 14: 63,528,247 F400L possibly damaging Het
Mto1 G A 9: 78,473,872 S666N probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nsg1 T C 5: 38,155,630 E75G probably benign Het
Nsun4 A G 4: 116,035,773 M283T probably benign Het
Obscn A G 11: 59,000,062 S7215P unknown Het
Olfr1042 A C 2: 86,159,574 S265R possibly damaging Het
Olfr1160 T C 2: 88,005,987 I264V probably damaging Het
Olfr1383 G A 11: 49,524,206 S161N possibly damaging Het
Olfr340 G A 2: 36,453,095 R170K probably benign Het
Olfr53 T C 7: 140,652,311 S111P probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Olfr736 T C 14: 50,392,864 I36T probably benign Het
Per1 T C 11: 69,104,043 F563S probably benign Het
Pik3c3 T A 18: 30,303,078 probably benign Het
Pitrm1 A T 13: 6,555,639 K207N probably damaging Het
Prdm10 C T 9: 31,316,230 R44C probably damaging Het
Rab40c A T 17: 25,885,148 I90N probably damaging Het
Rbl1 A G 2: 157,199,414 probably null Het
Rnf17 G A 14: 56,514,106 G1467E probably damaging Het
Rpgrip1 A G 14: 52,149,384 probably benign Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Scap T C 9: 110,372,222 I93T possibly damaging Het
Sez6 T C 11: 77,974,344 probably benign Het
Slc26a5 A C 5: 21,811,344 probably null Het
St18 T C 1: 6,848,948 V901A probably benign Het
Syne2 T C 12: 75,963,876 L2519P probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tmem51 T C 4: 142,031,925 T171A probably benign Het
Tns4 A T 11: 99,075,198 I453N probably damaging Het
Trank1 A T 9: 111,392,910 H2905L probably benign Het
Trim13 C T 14: 61,604,717 T61I possibly damaging Het
Trim75 T C 8: 64,982,928 Q290R possibly damaging Het
Ttn C A 2: 76,729,200 R29619L probably damaging Het
Ugt2b38 T A 5: 87,420,558 M293L probably benign Het
Vmn1r22 T A 6: 57,900,528 N155Y probably benign Het
Vmn2r18 T C 5: 151,584,804 Y285C probably benign Het
Vmn2r84 C T 10: 130,386,719 probably benign Het
Vwde A C 6: 13,220,005 L49R probably damaging Het
Yipf2 T A 9: 21,591,966 E68D possibly damaging Het
Zfand5 C A 19: 21,279,758 probably benign Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTGGGCACTAACTCATACACAT -3'
(R):5'- TAGGTAGAGGGAGACAGATCCCCACT -3'

Sequencing Primer
(F):5'- ACATGTGAAGCTTGTATTTCCTC -3'
(R):5'- GCATTATGTGGCTGAATCATTCTTC -3'
Posted On2014-01-08