Incidental Mutation 'R1024:Cacna2d2'
ID98759
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
MMRRC Submission 039126-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R1024 (G1)
Quality Score131
Status Not validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 107527050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably benign
Transcript: ENSMUST00000010210
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085092
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164988
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166799
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168532
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168959
Predicted Effect probably benign
Transcript: ENSMUST00000170737
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194842
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,677,409 S719P probably damaging Het
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dclk3 A G 9: 111,469,070 I561V possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nphs1 G T 7: 30,474,277 S939I probably damaging Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Oog2 A C 4: 144,196,286 T374P probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rfpl4 G T 7: 5,110,518 D215E probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GGCTCGGTGAACGCATCCTATAATG -3'
(R):5'- ATGTGCGGACCTCTTCGGTATCTC -3'

Sequencing Primer
(F):5'- CATCATTGACTGCGGAAACTG -3'
(R):5'- GTATCTCGGTCTCTGCACCAG -3'
Posted On2014-01-09