Incidental Mutation 'R1024:Dclk3'
ID98760
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Namedoublecortin-like kinase 3
SynonymsClick-I, -II related, Dcamkl3
MMRRC Submission 039126-MU
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock #R1024 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location111439081-111489118 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111469070 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 561 (I561V)
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111879
AA Change: I561V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500
AA Change: I561V

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.4%
  • 10x: 95.6%
  • 20x: 90.2%
Validation Efficiency 90% (36/40)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap13 T C 7: 75,677,409 S719P probably damaging Het
Atxn2l A T 7: 126,497,294 N425K probably benign Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Cacna2d2 T C 9: 107,527,050 probably null Het
Ccar2 A G 14: 70,140,515 S674P probably damaging Het
Ccm2 T A 11: 6,570,119 Y56* probably null Het
Cdc14b A T 13: 64,215,676 V257E probably damaging Het
Cdca8 A C 4: 124,922,005 S171R probably benign Het
Cep192 C T 18: 67,838,054 T1042I probably benign Het
Cfap100 T A 6: 90,413,004 T101S possibly damaging Het
Cfap46 T A 7: 139,642,597 M1155L probably benign Het
Cyp3a13 T A 5: 137,894,364 I473F possibly damaging Het
Dock6 A T 9: 21,833,612 L556H probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Drd1 T A 13: 54,053,314 M294L probably benign Het
Dsel A G 1: 111,860,673 S711P probably damaging Het
Fcho2 A T 13: 98,732,659 I568N probably damaging Het
Folr1 A G 7: 101,858,603 M210T probably damaging Het
Gatc T A 5: 115,340,845 probably null Het
Gja8 A T 3: 96,919,424 F307L probably benign Het
H1fnt G A 15: 98,256,755 T171I unknown Het
Hnrnpd C A 5: 99,966,157 *87L probably null Het
Hpd C T 5: 123,174,469 R279H possibly damaging Het
Igfals G A 17: 24,880,483 V183M probably damaging Het
Izumo1 A G 7: 45,627,174 Y387C probably benign Het
Kdm5a A G 6: 120,399,038 N585S probably null Het
March2 C A 17: 33,709,788 G45C probably damaging Het
Myo15 A T 11: 60,479,616 R1067S probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nell1 A G 7: 50,120,663 S157G probably damaging Het
Nf1 A T 11: 79,547,033 E2072D probably damaging Het
Nipal1 CGGG CGG 5: 72,667,991 probably null Het
Nop2 T A 6: 125,137,186 V205E probably benign Het
Nphs1 G T 7: 30,474,277 S939I probably damaging Het
Nudt8 T A 19: 4,001,925 W179R probably damaging Het
Nutm1 A T 2: 112,249,929 I547N probably benign Het
Olfr729 A T 14: 50,147,927 F316I probably benign Het
Olfr921 C A 9: 38,775,335 L27I probably damaging Het
Oog2 A C 4: 144,196,286 T374P probably damaging Het
Otud4 T A 8: 79,664,093 M413K probably benign Het
Pear1 A G 3: 87,760,299 probably benign Het
Pla2g3 G A 11: 3,488,551 C67Y probably damaging Het
Plxdc2 A G 2: 16,712,106 T334A probably benign Het
Ppl G A 16: 5,100,000 R543W probably damaging Het
Prl5a1 G A 13: 28,149,897 V128I probably damaging Het
Pth1r T C 9: 110,729,621 D96G probably benign Het
Pth1r A T 9: 110,742,227 L25Q probably damaging Het
Rfpl4 G T 7: 5,110,518 D215E probably damaging Het
Rnf146 T A 10: 29,347,096 R265* probably null Het
Rpe65 T C 3: 159,606,485 I207T probably benign Het
Rptn A G 3: 93,398,225 E955G possibly damaging Het
Rwdd2b A T 16: 87,436,850 C121S probably damaging Het
Scn10a A G 9: 119,609,274 I1843T probably damaging Het
Sirt5 A G 13: 43,370,769 I6V probably benign Het
Slc25a36 A G 9: 97,079,201 Y261H probably damaging Het
Slc5a3 G A 16: 92,077,495 A147T probably damaging Het
Stk39 T C 2: 68,410,046 S114G probably damaging Het
Stxbp1 T C 2: 32,814,967 probably null Het
Syt3 G T 7: 44,390,682 G113V probably damaging Het
Tatdn2 A G 6: 113,709,545 T644A probably damaging Het
Trim9 T A 12: 70,252,017 probably null Het
Tut1 A G 19: 8,959,355 N181S probably benign Het
Vill T C 9: 119,066,824 S151P probably damaging Het
Vmn2r90 A T 17: 17,728,138 I549F probably damaging Het
Wdfy4 T C 14: 33,079,966 T1912A possibly damaging Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111482721 missense probably damaging 1.00
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4111:Dclk3 UTSW 9 111469080 missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5338:Dclk3 UTSW 9 111469059 missense possibly damaging 0.95
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGCATCATCTCAGCGGATGTG -3'
(R):5'- ACGTCCCGGTGGACGATATTCTTG -3'

Sequencing Primer
(F):5'- CATCTCAGCGGATGTGGAGAAG -3'
(R):5'- TGCATGTGGACGAGGGC -3'
Posted On2014-01-09