Mutagenetix > Incidental Mutation

Incidental Mutation 'R1022:Folr1'

98784

Institutional Source

Beutler Lab

Gene Symbol

Folr1

Ensembl Gene

ENSMUSG00000001827

Gene Name

folate receptor alpha

Synonyms

folate receptor [a], Folbp1, FBP1, folate-binding protein 1, Folbp-1

MMRRC Submission

039124-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1022 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101507551-101519974 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101507810 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 210 (M210T)

Ref Sequence

ENSEMBL: ENSMUSP00000102599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106981] [ENSMUST00000106982] [ENSMUST00000106983] [ENSMUST00000106985] [ENSMUST00000106986] [ENSMUST00000126204] [ENSMUST00000134145] [ENSMUST00000210598] [ENSMUST00000140068] [ENSMUST00000151706]

AlphaFold

P35846

Predicted Effect

probably damaging
Transcript: ENSMUST00000106981
AA Change: M210T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102594
Gene: ENSMUSG00000001827
AA Change: M210T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	209	2.4e-61	PFAM
low complexity region	242	251	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106982
AA Change: M210T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102595
Gene: ENSMUSG00000001827
AA Change: M210T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	209	2.4e-61	PFAM
low complexity region	242	251	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106983
AA Change: M210T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102596
Gene: ENSMUSG00000001827
AA Change: M210T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	209	4.2e-68	PFAM
low complexity region	242	251	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106985
AA Change: M210T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102598
Gene: ENSMUSG00000001827
AA Change: M210T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	209	2.4e-61	PFAM
low complexity region	242	251	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106986
AA Change: M210T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102599
Gene: ENSMUSG00000001827
AA Change: M210T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	209	2.4e-61	PFAM
low complexity region	242	251	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126204

SMART Domains

Protein: ENSMUSP00000117175
Gene: ENSMUSG00000001827

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	137	2.9e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134145

SMART Domains

Protein: ENSMUSP00000118547
Gene: ENSMUSG00000001827

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	104	2.6e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210598

Predicted Effect

probably benign
Transcript: ENSMUST00000140068

SMART Domains

Protein: ENSMUSP00000114633
Gene: ENSMUSG00000001827

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	160	9.5e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000151706

SMART Domains

Protein: ENSMUSP00000115077
Gene: ENSMUSG00000001827

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Folate_rec	34	157	8.9e-47	PFAM

Coding Region Coverage

1x: 98.9%
3x: 97.7%
10x: 94.5%
20x: 87.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Embryos homozygous for a knock-out allele are growth retarded and malformed, show multiple developmental anomalies, including neural and craniofacial defects, and die by E10. Folate supplementation of pregnant dams reduces embryonic mortality and improves many of the adverse developmental effects. [provided by MGI curators]

Allele List at MGI

All alleles(359) : Targeted(3) Gene trapped(356)

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atxn2l	A	T	7: 126,096,466 (GRCm39)	N425K	probably benign	Het
Ccar2	A	G	14: 70,377,964 (GRCm39)	S674P	probably damaging	Het
Cdc14b	A	T	13: 64,363,490 (GRCm39)	V257E	probably damaging	Het
Cfap100	T	A	6: 90,389,986 (GRCm39)	T101S	possibly damaging	Het
Dock6	A	T	9: 21,744,908 (GRCm39)	L556H	probably damaging	Het
Dqx1	G	A	6: 83,038,070 (GRCm39)	C486Y	probably damaging	Het
Drd1	T	A	13: 54,207,333 (GRCm39)	M294L	probably benign	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,084,988 (GRCm39)		probably benign	Het
Fcho2	A	T	13: 98,869,167 (GRCm39)	I568N	probably damaging	Het
Gatc	T	A	5: 115,478,904 (GRCm39)		probably null	Het
H1f7	G	A	15: 98,154,636 (GRCm39)	T171I	unknown	Het
Hnrnpd	C	A	5: 100,114,016 (GRCm39)	*87L	probably null	Het
Hpd	C	T	5: 123,312,532 (GRCm39)	R279H	possibly damaging	Het
Igfals	G	A	17: 25,099,457 (GRCm39)	V183M	probably damaging	Het
Marchf2	C	A	17: 33,928,762 (GRCm39)	G45C	probably damaging	Het
Myo15a	A	T	11: 60,370,442 (GRCm39)	R1067S	probably benign	Het
Nell1	A	G	7: 49,770,411 (GRCm39)	S157G	probably damaging	Het
Nf1	A	T	11: 79,437,859 (GRCm39)	E2072D	probably damaging	Het
Nop2	T	A	6: 125,114,149 (GRCm39)	V205E	probably benign	Het
Nudt8	T	A	19: 4,051,925 (GRCm39)	W179R	probably damaging	Het
Or4k5	A	T	14: 50,385,384 (GRCm39)	F316I	probably benign	Het
Otx2	TCTGCTGCTGCTGCTGCTG	TCTGCTGCTGCTGCTG	14: 48,896,729 (GRCm39)		probably benign	Het
Prl5a1	G	A	13: 28,333,880 (GRCm39)	V128I	probably damaging	Het
Pth1r	A	T	9: 110,571,295 (GRCm39)	L25Q	probably damaging	Het
Pth1r	T	C	9: 110,558,689 (GRCm39)	D96G	probably benign	Het
Rwdd2b	A	T	16: 87,233,738 (GRCm39)	C121S	probably damaging	Het
Scn10a	A	G	9: 119,438,340 (GRCm39)	I1843T	probably damaging	Het
Sirt5	A	G	13: 43,524,245 (GRCm39)	I6V	probably benign	Het
Slc5a3	G	A	16: 91,874,383 (GRCm39)	A147T	probably damaging	Het
Stxbp1	T	C	2: 32,704,979 (GRCm39)		probably null	Het
Syt3	G	T	7: 44,040,106 (GRCm39)	G113V	probably damaging	Het
Tatdn2	A	G	6: 113,686,506 (GRCm39)	T644A	probably damaging	Het
Trim9	T	A	12: 70,298,791 (GRCm39)		probably null	Het
Tut1	A	G	19: 8,936,719 (GRCm39)	N181S	probably benign	Het
Vmn2r90	A	T	17: 17,948,400 (GRCm39)	I549F	probably damaging	Het

Other mutations in Folr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01916:Folr1	APN	7	101,507,947 (GRCm39)	missense	probably benign	0.00
IGL02423:Folr1	APN	7	101,507,732 (GRCm39)	missense	probably benign	0.00
R0071:Folr1	UTSW	7	101,513,130 (GRCm39)	critical splice donor site	probably null
R0071:Folr1	UTSW	7	101,513,130 (GRCm39)	critical splice donor site	probably null
R1024:Folr1	UTSW	7	101,507,810 (GRCm39)	missense	probably damaging	0.98
R1562:Folr1	UTSW	7	101,507,801 (GRCm39)	missense	probably damaging	0.98
R2299:Folr1	UTSW	7	101,513,199 (GRCm39)	missense	probably damaging	1.00
R3690:Folr1	UTSW	7	101,507,745 (GRCm39)	missense	probably benign	0.06
R4746:Folr1	UTSW	7	101,513,184 (GRCm39)	missense	probably damaging	1.00
R4747:Folr1	UTSW	7	101,513,184 (GRCm39)	missense	probably damaging	1.00
R5319:Folr1	UTSW	7	101,513,184 (GRCm39)	missense	probably damaging	1.00
R6243:Folr1	UTSW	7	101,513,172 (GRCm39)	missense	probably damaging	1.00
R6275:Folr1	UTSW	7	101,508,742 (GRCm39)	missense	probably damaging	0.99
R7284:Folr1	UTSW	7	101,508,677 (GRCm39)	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- TTAAAGAGGCTGTCAGAGCCCCAC -3'
(R):5'- GCACAGGGACTAACGATCTTCCATC -3'

Sequencing Primer
(F):5'- CCACCACAAAGGAGGCTGG -3'
(R):5'- GCTGCTCTGTGTGAGGAAATCT -3'

Posted On

2014-01-09