Incidental Mutation 'R1022:Pth1r'
ID 98791
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Name parathyroid hormone 1 receptor
Synonyms PTH/PTHrP receptor, PTH-related peptide receptor, PTH1R, PPR, Pthr1
MMRRC Submission 039124-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1022 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 110551153-110576213 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110558689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 96 (D96G)
Ref Sequence ENSEMBL: ENSMUSP00000006005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000196057] [ENSMUST00000198865] [ENSMUST00000199791] [ENSMUST00000199862]
AlphaFold P41593
Predicted Effect probably benign
Transcript: ENSMUST00000006005
AA Change: D96G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492
AA Change: D96G

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166716
AA Change: D96G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492
AA Change: D96G

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196057
AA Change: D96G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143470
Gene: ENSMUSG00000032492
AA Change: D96G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
HormR 104 179 7.8e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198865
AA Change: D96G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492
AA Change: D96G

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199791
SMART Domains Protein: ENSMUSP00000142957
Gene: ENSMUSG00000032492

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199862
AA Change: D90G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142672
Gene: ENSMUSG00000032492
AA Change: D90G

DomainStartEndE-ValueType
HormR 98 173 7.8e-28 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.7%
  • 10x: 94.5%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A T 7: 126,096,466 (GRCm39) N425K probably benign Het
Ccar2 A G 14: 70,377,964 (GRCm39) S674P probably damaging Het
Cdc14b A T 13: 64,363,490 (GRCm39) V257E probably damaging Het
Cfap100 T A 6: 90,389,986 (GRCm39) T101S possibly damaging Het
Dock6 A T 9: 21,744,908 (GRCm39) L556H probably damaging Het
Dqx1 G A 6: 83,038,070 (GRCm39) C486Y probably damaging Het
Drd1 T A 13: 54,207,333 (GRCm39) M294L probably benign Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,084,988 (GRCm39) probably benign Het
Fcho2 A T 13: 98,869,167 (GRCm39) I568N probably damaging Het
Folr1 A G 7: 101,507,810 (GRCm39) M210T probably damaging Het
Gatc T A 5: 115,478,904 (GRCm39) probably null Het
H1f7 G A 15: 98,154,636 (GRCm39) T171I unknown Het
Hnrnpd C A 5: 100,114,016 (GRCm39) *87L probably null Het
Hpd C T 5: 123,312,532 (GRCm39) R279H possibly damaging Het
Igfals G A 17: 25,099,457 (GRCm39) V183M probably damaging Het
Marchf2 C A 17: 33,928,762 (GRCm39) G45C probably damaging Het
Myo15a A T 11: 60,370,442 (GRCm39) R1067S probably benign Het
Nell1 A G 7: 49,770,411 (GRCm39) S157G probably damaging Het
Nf1 A T 11: 79,437,859 (GRCm39) E2072D probably damaging Het
Nop2 T A 6: 125,114,149 (GRCm39) V205E probably benign Het
Nudt8 T A 19: 4,051,925 (GRCm39) W179R probably damaging Het
Or4k5 A T 14: 50,385,384 (GRCm39) F316I probably benign Het
Otx2 TCTGCTGCTGCTGCTGCTG TCTGCTGCTGCTGCTG 14: 48,896,729 (GRCm39) probably benign Het
Prl5a1 G A 13: 28,333,880 (GRCm39) V128I probably damaging Het
Rwdd2b A T 16: 87,233,738 (GRCm39) C121S probably damaging Het
Scn10a A G 9: 119,438,340 (GRCm39) I1843T probably damaging Het
Sirt5 A G 13: 43,524,245 (GRCm39) I6V probably benign Het
Slc5a3 G A 16: 91,874,383 (GRCm39) A147T probably damaging Het
Stxbp1 T C 2: 32,704,979 (GRCm39) probably null Het
Syt3 G T 7: 44,040,106 (GRCm39) G113V probably damaging Het
Tatdn2 A G 6: 113,686,506 (GRCm39) T644A probably damaging Het
Trim9 T A 12: 70,298,791 (GRCm39) probably null Het
Tut1 A G 19: 8,936,719 (GRCm39) N181S probably benign Het
Vmn2r90 A T 17: 17,948,400 (GRCm39) I549F probably damaging Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110,556,198 (GRCm39) missense probably damaging 0.99
IGL01682:Pth1r APN 9 110,552,774 (GRCm39) splice site probably null
IGL02004:Pth1r APN 9 110,571,376 (GRCm39) intron probably benign
IGL02169:Pth1r APN 9 110,553,503 (GRCm39) missense probably damaging 1.00
IGL02548:Pth1r APN 9 110,556,748 (GRCm39) missense probably damaging 1.00
IGL03201:Pth1r APN 9 110,551,648 (GRCm39) missense probably damaging 1.00
R0070:Pth1r UTSW 9 110,556,618 (GRCm39) splice site probably null
R0881:Pth1r UTSW 9 110,560,641 (GRCm39) missense probably damaging 1.00
R1022:Pth1r UTSW 9 110,571,295 (GRCm39) missense probably damaging 0.96
R1024:Pth1r UTSW 9 110,571,295 (GRCm39) missense probably damaging 0.96
R1024:Pth1r UTSW 9 110,558,689 (GRCm39) missense probably benign 0.01
R2071:Pth1r UTSW 9 110,556,081 (GRCm39) missense probably benign 0.34
R2197:Pth1r UTSW 9 110,556,058 (GRCm39) unclassified probably benign
R2206:Pth1r UTSW 9 110,552,655 (GRCm39) missense probably damaging 1.00
R4184:Pth1r UTSW 9 110,571,300 (GRCm39) start codon destroyed probably null
R4590:Pth1r UTSW 9 110,551,339 (GRCm39) missense probably benign 0.04
R4638:Pth1r UTSW 9 110,556,141 (GRCm39) missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110,560,692 (GRCm39) missense probably damaging 1.00
R5457:Pth1r UTSW 9 110,555,522 (GRCm39) missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110,551,384 (GRCm39) missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110,556,319 (GRCm39) splice site probably null
R6683:Pth1r UTSW 9 110,556,319 (GRCm39) splice site probably null
R6914:Pth1r UTSW 9 110,557,084 (GRCm39) splice site probably null
R6942:Pth1r UTSW 9 110,557,084 (GRCm39) splice site probably null
R7164:Pth1r UTSW 9 110,552,815 (GRCm39) missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110,551,461 (GRCm39) missense probably benign
R7883:Pth1r UTSW 9 110,560,626 (GRCm39) missense probably benign 0.02
R8966:Pth1r UTSW 9 110,554,229 (GRCm39) missense possibly damaging 0.79
R9168:Pth1r UTSW 9 110,556,204 (GRCm39) missense probably benign 0.31
R9585:Pth1r UTSW 9 110,573,847 (GRCm39) missense probably benign 0.00
R9773:Pth1r UTSW 9 110,556,233 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTCTTTACCTCAGTGGATCACGGG -3'
(R):5'- TACAGCACAGCCGATGGCTAGAAC -3'

Sequencing Primer
(F):5'- CTCAGTGGATCACGGGTTTCC -3'
(R):5'- GGCTAGAACCACCCCCATTTC -3'
Posted On 2014-01-09