Incidental Mutation 'T0722:Sytl1'
ID99023
Institutional Source Beutler Lab
Gene Symbol Sytl1
Ensembl Gene ENSMUSG00000028860
Gene Namesynaptotagmin-like 1
SynonymsPSGL-1, Slp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #T0722 (G3) of strain 711
Quality Score67
Status Validated
Chromosome4
Chromosomal Location133253090-133263113 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 133256851 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030677
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased number of acinar zygomen granules in a fasted state that can be released by strong stimuli of the fed state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A G 12: 113,489,577 T5A possibly damaging Het
Adam6b T A 12: 113,491,268 D568E probably benign Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 T G 4: 126,404,296 T144P probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Atp6v1g3 T A 1: 138,273,853 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bicd2 C A 13: 49,379,651 P571Q probably benign Het
Camta2 A G 11: 70,684,005 I75T probably damaging Het
Casp1 A T 9: 5,299,851 H108L probably benign Het
Cdk5r1 G T 11: 80,477,881 V125F probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Cngb1 A G 8: 95,296,650 M240T probably benign Het
Cngb1 G T 8: 95,297,819 Q205K probably damaging Het
Cngb1 T C 8: 95,303,696 probably benign Het
Cngb1 G A 8: 95,303,714 probably benign Het
Cog8 G T 8: 107,048,993 L580I probably benign Het
Copa A G 1: 172,111,948 E593G possibly damaging Het
Ctrc T TA 4: 141,845,196 probably null Het
Cwf19l2 T C 9: 3,456,755 F696S probably benign Het
Ddi2 G A 4: 141,713,473 probably benign Het
Eml5 T C 12: 98,841,582 D984G probably null Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Fstl3 A G 10: 79,780,163 Y161C probably damaging Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm8186 C T 17: 26,099,127 R32Q probably benign Het
Gm8394 A G 10: 85,313,593 noncoding transcript Het
Jakmip1 C A 5: 37,118,903 A519D probably damaging Het
Jcad G T 18: 4,675,531 A1098S probably benign Het
Klhl14 T C 18: 21,558,135 Y446C probably damaging Het
Lims1 A G 10: 58,418,455 N344D probably benign Het
Marco A T 1: 120,474,712 W502R probably damaging Het
Mmp13 G T 9: 7,280,857 M413I possibly damaging Het
Mmp25 G A 17: 23,631,218 A456V possibly damaging Het
Msi2 A T 11: 88,394,597 M207K probably damaging Het
Myh8 G A 11: 67,304,436 R1692Q probably benign Het
Nbas A G 12: 13,352,808 I788V probably benign Het
Nup188 A G 2: 30,322,681 D632G probably damaging Het
Olfr1141 T A 2: 87,753,123 Y290F probably damaging Het
Olfr1219 A G 2: 89,074,959 V44A probably benign Het
Olfr354 T C 2: 36,907,570 V208A probably benign Het
Olfr360 T G 2: 37,068,437 L44R probably damaging Het
Opa1 T C 16: 29,610,930 probably null Het
Pabpc1l G A 2: 164,042,420 G359D possibly damaging Het
Papd7 G A 13: 69,506,955 R224* probably null Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Qser1 A G 2: 104,786,832 C1122R possibly damaging Het
Rfx8 A G 1: 39,683,612 S282P probably damaging Het
Sec14l2 C T 11: 4,103,673 probably null Het
Sim2 C A 16: 94,109,422 H228N probably benign Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc30a6 T A 17: 74,412,324 probably null Het
Smarcc1 G A 9: 110,206,085 E859K possibly damaging Het
Snx1 CTT CTTGTT 9: 66,104,927 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Spta1 A G 1: 174,191,066 probably benign Het
Terf2 T C 8: 107,076,674 K425E probably benign Het
Tmem26 A G 10: 68,778,718 E321G probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Uck2 A T 1: 167,234,711 D149E probably benign Het
Wnt5a G A 14: 28,511,925 A17T probably benign Het
Yif1b T C 7: 29,238,613 probably null Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Sytl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01899:Sytl1 APN 4 133258856 splice site probably null
IGL02693:Sytl1 APN 4 133257746 missense probably benign 0.03
IGL02721:Sytl1 APN 4 133258878 missense probably benign 0.25
IGL02975:Sytl1 APN 4 133261032 missense probably benign 0.05
FR4304:Sytl1 UTSW 4 133256993 small deletion probably benign
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0242:Sytl1 UTSW 4 133253457 missense probably damaging 1.00
R0677:Sytl1 UTSW 4 133253225 missense possibly damaging 0.89
R1135:Sytl1 UTSW 4 133256970 missense probably damaging 1.00
R1269:Sytl1 UTSW 4 133256115 missense probably damaging 1.00
R2018:Sytl1 UTSW 4 133256160 missense probably damaging 0.99
R2106:Sytl1 UTSW 4 133257463 missense probably benign 0.00
R3938:Sytl1 UTSW 4 133255624 nonsense probably null
R4210:Sytl1 UTSW 4 133253565 missense probably damaging 1.00
R4970:Sytl1 UTSW 4 133255582 nonsense probably null
R5027:Sytl1 UTSW 4 133256219 intron probably benign
R5325:Sytl1 UTSW 4 133261071 start gained probably benign
R5557:Sytl1 UTSW 4 133259356 missense probably damaging 1.00
R6310:Sytl1 UTSW 4 133260998 missense probably benign 0.34
T0722:Sytl1 UTSW 4 133256853 splice site probably benign
T0975:Sytl1 UTSW 4 133256994 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGATGACAGAACCCTTGATGCCTC -3'
(R):5'- CAGCCTCAATTCCTCTACGGTGAAG -3'

Sequencing Primer
(F):5'- TTCACGTAGCTGGGCAAG -3'
(R):5'- TATGGGGACCCTGATCATCCAC -3'
Posted On2014-01-10