Incidental Mutation 'R1212:Ttc30a2'
ID99426
Institutional Source Beutler Lab
Gene Symbol Ttc30a2
Ensembl Gene ENSMUSG00000075272
Gene Nametetratricopeptide repeat domain 30A2
SynonymsOTTMUSG00000015167
MMRRC Submission 039281-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1212 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location75975740-75978170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75976479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 563 (I563N)
Ref Sequence ENSEMBL: ENSMUSP00000097575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably benign
Transcript: ENSMUST00000099994
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099995
AA Change: I563N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272
AA Change: I563N

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 82.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ambra1 G A 2: 91,769,036 R167H possibly damaging Het
Ankrd50 G A 3: 38,455,687 R844C probably damaging Het
Arfgef1 T C 1: 10,216,559 E42G probably benign Het
Arhgap42 T A 9: 9,015,312 I444F probably damaging Het
BC067074 G A 13: 113,369,417 probably benign Het
Il25 G A 14: 54,932,755 probably benign Het
Jak1 A G 4: 101,189,094 L105P probably damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Ralgapa2 A G 2: 146,357,982 V1214A probably benign Het
Shtn1 T C 19: 59,050,890 D39G probably damaging Het
Supt16 G A 14: 52,174,124 R601* probably null Het
Ttc26 A G 6: 38,410,793 D393G probably damaging Het
Vmn1r113 A T 7: 20,787,431 R49S probably benign Het
Vmn1r64 C T 7: 5,884,211 S111N probably damaging Het
Other mutations in Ttc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Ttc30a2 APN 2 75976338 missense probably benign 0.16
IGL03269:Ttc30a2 APN 2 75978135 missense possibly damaging 0.50
R0011:Ttc30a2 UTSW 2 75976217 missense probably damaging 1.00
R0751:Ttc30a2 UTSW 2 75978031 missense probably damaging 0.99
R0766:Ttc30a2 UTSW 2 75976332 missense probably benign 0.00
R0835:Ttc30a2 UTSW 2 75978150 missense probably benign
R1133:Ttc30a2 UTSW 2 75977383 nonsense probably null
R1312:Ttc30a2 UTSW 2 75976332 missense probably benign 0.00
R4780:Ttc30a2 UTSW 2 75977576 missense probably benign 0.19
R4799:Ttc30a2 UTSW 2 75977385 missense probably benign 0.01
R4847:Ttc30a2 UTSW 2 75977714 missense probably benign 0.03
R5176:Ttc30a2 UTSW 2 75977077 missense probably benign
R5390:Ttc30a2 UTSW 2 75977286 missense probably damaging 1.00
R5724:Ttc30a2 UTSW 2 75977730 missense probably benign
R6975:Ttc30a2 UTSW 2 75976408 missense probably damaging 1.00
R6975:Ttc30a2 UTSW 2 75977660 nonsense probably null
R7028:Ttc30a2 UTSW 2 75976269 nonsense probably null
R7234:Ttc30a2 UTSW 2 75976196 nonsense probably null
R7246:Ttc30a2 UTSW 2 75977679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGTGGAAAGGCTGTCATAGTG -3'
(R):5'- CCATGTCCTCTTCATGCAGGAGAAC -3'

Sequencing Primer
(F):5'- TCCAAGGGCTGTTCTATGAC -3'
(R):5'- AACATCCTGAGTGTCAGTGC -3'
Posted On2014-01-15