Mutagenetix > Incidental Mutation

Incidental Mutation 'R1214:Slc26a5'

99513

Institutional Source

Beutler Lab

Gene Symbol

Slc26a5

Ensembl Gene

ENSMUSG00000029015

Gene Name

solute carrier family 26, member 5

Synonyms

prestin, Pres

MMRRC Submission

039283-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1214 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22015653-22070602 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22019981 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 530 (I530F)

Ref Sequence

ENSEMBL: ENSMUSP00000110830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]

AlphaFold

Q99NH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000030878
AA Change: I567F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: I567F

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	80	475	3.3e-109	PFAM
transmembrane domain	476	498	N/A	INTRINSIC
Pfam:STAS	526	709	3.3e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115176
AA Change: I530F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: I530F

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	106	5.2e-9	PFAM
Pfam:Sulfate_transp	156	434	1.6e-65	PFAM
transmembrane domain	439	461	N/A	INTRINSIC
Pfam:STAS	489	672	1.5e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127975
AA Change: I535F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: I535F

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	4.3e-33	PFAM
Pfam:Sulfate_transp	193	440	8.9e-56	PFAM
transmembrane domain	447	469	N/A	INTRINSIC
Pfam:STAS	494	677	4.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142888

SMART Domains

Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	65	148	2.1e-33	PFAM
Pfam:Sulfate_transp	193	441	9.6e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150012

Meta Mutation Damage Score

0.3954

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alkbh2	C	T	5: 114,262,287 (GRCm39)	E148K	probably damaging	Het
Dcdc2c	A	T	12: 28,580,429 (GRCm39)	Y201*	probably null	Het
Dock9	C	T	14: 121,823,728 (GRCm39)	V1395I	probably benign	Het
Dync1h1	G	A	12: 110,602,943 (GRCm39)	E2195K	probably benign	Het
Micall2	T	C	5: 139,697,396 (GRCm39)	S652G	probably damaging	Het
Or1j13	G	T	2: 36,369,981 (GRCm39)	H54N	possibly damaging	Het
Or2ad1	C	T	13: 21,326,337 (GRCm39)	V297I	probably benign	Het
Or4f4b	T	C	2: 111,314,237 (GRCm39)	F154S	probably damaging	Het
Ptpre	A	T	7: 135,280,987 (GRCm39)	S643C	probably damaging	Het
Slfn5	A	G	11: 82,850,917 (GRCm39)	M405V	probably benign	Het
Ttc29	A	G	8: 79,052,211 (GRCm39)	Y364C	probably damaging	Het
Tut7	A	G	13: 59,953,140 (GRCm39)	V100A	possibly damaging	Het
Wasf3	G	A	5: 146,407,098 (GRCm39)	V473M	probably damaging	Het

Other mutations in Slc26a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Slc26a5	APN	5	22,020,734 (GRCm39)	missense	probably damaging	1.00
IGL02486:Slc26a5	APN	5	22,051,323 (GRCm39)	missense	probably damaging	1.00
IGL02639:Slc26a5	APN	5	22,024,765 (GRCm39)	missense	probably damaging	1.00
IGL02810:Slc26a5	APN	5	22,018,381 (GRCm39)	splice site	probably benign
R0002:Slc26a5	UTSW	5	22,019,981 (GRCm39)	missense	probably damaging	1.00
R0002:Slc26a5	UTSW	5	22,019,981 (GRCm39)	missense	probably damaging	1.00
R0089:Slc26a5	UTSW	5	22,016,342 (GRCm39)	splice site	probably null
R0136:Slc26a5	UTSW	5	22,039,345 (GRCm39)	missense	probably damaging	1.00
R0212:Slc26a5	UTSW	5	22,028,547 (GRCm39)	nonsense	probably null
R0522:Slc26a5	UTSW	5	22,051,343 (GRCm39)	missense	probably damaging	0.96
R0557:Slc26a5	UTSW	5	22,024,762 (GRCm39)	missense	probably damaging	1.00
R0711:Slc26a5	UTSW	5	22,052,230 (GRCm39)	missense	probably damaging	1.00
R0959:Slc26a5	UTSW	5	22,021,959 (GRCm39)	missense	probably benign	0.01
R1471:Slc26a5	UTSW	5	22,021,962 (GRCm39)	missense	probably benign	0.12
R1647:Slc26a5	UTSW	5	22,018,974 (GRCm39)	nonsense	probably null
R1648:Slc26a5	UTSW	5	22,018,974 (GRCm39)	nonsense	probably null
R1861:Slc26a5	UTSW	5	22,021,956 (GRCm39)	missense	possibly damaging	0.93
R1875:Slc26a5	UTSW	5	22,020,725 (GRCm39)	missense	probably benign	0.03
R2106:Slc26a5	UTSW	5	22,028,542 (GRCm39)	missense	probably damaging	1.00
R2169:Slc26a5	UTSW	5	22,018,863 (GRCm39)	missense	probably damaging	1.00
R2219:Slc26a5	UTSW	5	22,028,476 (GRCm39)	missense	probably damaging	1.00
R2276:Slc26a5	UTSW	5	22,028,545 (GRCm39)	missense	probably benign	0.39
R2281:Slc26a5	UTSW	5	22,036,508 (GRCm39)	missense	possibly damaging	0.94
R2325:Slc26a5	UTSW	5	22,024,692 (GRCm39)	missense	probably damaging	1.00
R4031:Slc26a5	UTSW	5	22,052,189 (GRCm39)	missense	probably damaging	1.00
R4793:Slc26a5	UTSW	5	22,042,992 (GRCm39)	missense	probably damaging	1.00
R4941:Slc26a5	UTSW	5	22,025,384 (GRCm39)	missense	probably damaging	1.00
R5122:Slc26a5	UTSW	5	22,052,194 (GRCm39)	missense	probably damaging	1.00
R5274:Slc26a5	UTSW	5	22,018,899 (GRCm39)	missense	possibly damaging	0.74
R5312:Slc26a5	UTSW	5	22,052,258 (GRCm39)	missense	probably damaging	0.99
R5628:Slc26a5	UTSW	5	22,021,974 (GRCm39)	missense	probably benign	0.20
R5806:Slc26a5	UTSW	5	22,028,561 (GRCm39)	missense	probably damaging	1.00
R6227:Slc26a5	UTSW	5	22,026,095 (GRCm39)	missense	probably damaging	1.00
R6525:Slc26a5	UTSW	5	22,025,348 (GRCm39)	missense	possibly damaging	0.77
R6609:Slc26a5	UTSW	5	22,024,717 (GRCm39)	missense	possibly damaging	0.93
R6885:Slc26a5	UTSW	5	22,039,342 (GRCm39)	missense	probably damaging	1.00
R6974:Slc26a5	UTSW	5	22,045,570 (GRCm39)	missense	probably damaging	1.00
R7001:Slc26a5	UTSW	5	22,016,334 (GRCm39)	missense	probably damaging	1.00
R7027:Slc26a5	UTSW	5	22,021,972 (GRCm39)	missense	possibly damaging	0.60
R7174:Slc26a5	UTSW	5	22,018,892 (GRCm39)	missense	probably damaging	1.00
R7184:Slc26a5	UTSW	5	22,042,244 (GRCm39)	nonsense	probably null
R7650:Slc26a5	UTSW	5	22,039,328 (GRCm39)	missense	possibly damaging	0.96
R8431:Slc26a5	UTSW	5	22,018,904 (GRCm39)	missense	probably damaging	1.00
R8812:Slc26a5	UTSW	5	22,018,880 (GRCm39)	missense	probably damaging	1.00
R9184:Slc26a5	UTSW	5	22,018,880 (GRCm39)	missense	probably damaging	1.00
R9215:Slc26a5	UTSW	5	22,042,285 (GRCm39)	missense	possibly damaging	0.93
R9281:Slc26a5	UTSW	5	22,019,051 (GRCm39)	missense	probably benign	0.39
R9324:Slc26a5	UTSW	5	22,018,334 (GRCm39)	missense	possibly damaging	0.73
R9516:Slc26a5	UTSW	5	22,016,337 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCATGACAGGCCACAAGTTACCAG -3'
(R):5'- TAACTCAGCTCAGGGCATCTGAGG -3'

Sequencing Primer
(F):5'- atctcttgcctctgccttc -3'
(R):5'- CATCTGAGGGCAGGGCAG -3'

Posted On

2014-01-15