Incidental Mutation 'R1172:Fry'
ID99553
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 039245-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.603) question?
Stock #R1172 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 150481494 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 793 (W793*)
Ref Sequence ENSEMBL: ENSMUSP00000144657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204] [ENSMUST00000202566]
Predicted Effect probably null
Transcript: ENSMUST00000087204
AA Change: W2803*
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602
AA Change: W2803*

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200863
AA Change: W435*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201196
Predicted Effect probably null
Transcript: ENSMUST00000202566
AA Change: W793*
SMART Domains Protein: ENSMUSP00000144657
Gene: ENSMUSG00000056602
AA Change: W793*

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_C 37 290 1.5e-71 PFAM
low complexity region 356 372 N/A INTRINSIC
low complexity region 447 472 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 832 848 N/A INTRINSIC
Meta Mutation Damage Score 0.552 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C A 4: 35,218,630 E76D probably damaging Het
Accsl A T 2: 93,866,244 probably benign Het
Adam7 T G 14: 68,514,921 K371N probably damaging Het
Adgrv1 A T 13: 81,557,063 S1543T probably damaging Het
Agbl4 A T 4: 111,656,318 probably benign Het
Arid1b T A 17: 5,339,300 I1707N probably damaging Het
Atp10a T C 7: 58,803,766 V864A probably benign Het
Bivm A G 1: 44,126,782 T131A probably benign Het
Bst1 A G 5: 43,825,408 probably null Het
Cblb T C 16: 52,186,240 probably benign Het
Ccdc28b T C 4: 129,620,889 probably benign Het
Cmas G T 6: 142,756,878 G36C probably benign Het
Eml6 A G 11: 29,749,824 S1771P possibly damaging Het
Epc1 A C 18: 6,490,525 Y31D probably damaging Het
Fbn1 A T 2: 125,394,687 C358S probably benign Het
Fbxl13 A T 5: 21,620,604 probably benign Het
Fermt2 T C 14: 45,459,968 D642G possibly damaging Het
Fmnl2 A T 2: 53,072,274 N257I probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Glipr1l2 C A 10: 112,083,466 L31I possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm10801 C T 2: 98,663,907 probably benign Het
Gm21718 T C 14: 51,315,891 noncoding transcript Het
Gpld1 A G 13: 24,957,566 probably null Het
Gtf3c2 A T 5: 31,168,075 Y500N probably damaging Het
Hbs1l A G 10: 21,304,638 D73G probably damaging Het
Idh1 G T 1: 65,161,160 N348K probably benign Het
Kank4 T C 4: 98,765,569 Y874C probably damaging Het
Lamc2 A T 1: 153,166,287 S34T probably damaging Het
Laptm4a T C 12: 8,936,716 V258A probably damaging Het
Lrrc19 A T 4: 94,638,389 Y310* probably null Het
Map3k5 G A 10: 20,056,648 probably benign Het
Map7 G A 10: 20,245,299 E92K probably damaging Het
Mettl24 G A 10: 40,737,708 A148T probably benign Het
Mosmo A G 7: 120,730,522 Y122C probably benign Het
Ncr1 T A 7: 4,338,121 I37N probably benign Het
Nkx3-1 T C 14: 69,191,985 S151P probably damaging Het
Npm2 T A 14: 70,652,221 K54* probably null Het
Npr1 T A 3: 90,461,382 D457V probably benign Het
Nudt21 T C 8: 94,031,129 probably benign Het
Pcnt A T 10: 76,393,044 probably null Het
Pik3r4 G T 9: 105,663,174 G754C probably damaging Het
Rftn2 A G 1: 55,211,217 V123A probably damaging Het
Rpa1 A T 11: 75,312,393 V392D probably damaging Het
Rxfp2 T C 5: 150,051,556 V210A probably benign Het
Slc45a4 C T 15: 73,605,429 probably benign Het
Syndig1l T A 12: 84,679,168 probably null Het
Tctn1 G A 5: 122,251,689 R257* probably null Het
Tenm4 A T 7: 96,848,044 E1179V probably damaging Het
Txlnb A G 10: 17,842,756 N445S probably benign Het
Tyrp1 C T 4: 80,844,868 Q331* probably null Het
Ubap2l A T 3: 90,023,500 S413T probably benign Het
Vdr A T 15: 97,869,333 Y185N probably benign Het
Vmn2r66 G T 7: 85,005,591 D503E probably benign Het
Vmn2r72 T A 7: 85,751,944 E89V probably damaging Het
Vmn2r87 T C 10: 130,477,584 T438A probably benign Het
Xrcc6 A G 15: 82,031,163 D94G probably damaging Het
Ywhaq T C 12: 21,395,023 N207S probably benign Het
Zfp185 A T X: 72,999,323 E138D possibly damaging Het
Zfp981 G A 4: 146,537,764 S382N probably benign Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R5933:Fry UTSW 5 150390800 intron probably benign
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
Predicted Primers
Posted On2014-01-15