Incidental Mutation 'R1216:Fyb2'
ID99630
Institutional Source Beutler Lab
Gene Symbol Fyb2
Ensembl Gene ENSMUSG00000078612
Gene NameFYN binding protein 2
Synonyms1700024P16Rik
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location104913456-105016863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104995706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 528 (V528M)
Ref Sequence ENSEMBL: ENSMUSP00000102415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106803] [ENSMUST00000106804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106803
AA Change: V528M

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102415
Gene: ENSMUSG00000078612
AA Change: V528M

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
low complexity region 442 459 N/A INTRINSIC
low complexity region 537 549 N/A INTRINSIC
low complexity region 567 578 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
SH3 735 791 3.82e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106804
AA Change: V464M

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102416
Gene: ENSMUSG00000078612
AA Change: V464M

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 276 285 N/A INTRINSIC
low complexity region 378 395 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
SH3 671 727 3.82e0 SMART
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Fyb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Fyb2 APN 4 105015716 missense probably damaging 1.00
IGL01155:Fyb2 APN 4 104999386 missense probably benign 0.00
IGL01632:Fyb2 APN 4 104995811 missense probably benign
IGL01746:Fyb2 APN 4 104945207 missense probably benign 0.01
IGL02381:Fyb2 APN 4 104948666 splice site probably benign
IGL02590:Fyb2 APN 4 104979053 missense probably damaging 1.00
IGL02885:Fyb2 APN 4 105003921 missense probably damaging 0.99
IGL03114:Fyb2 APN 4 104995778 missense probably damaging 0.97
IGL03189:Fyb2 APN 4 105015742 missense probably damaging 1.00
IGL03231:Fyb2 APN 4 104986263 nonsense probably null
R0076:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R0662:Fyb2 UTSW 4 104995698 missense possibly damaging 0.46
R0723:Fyb2 UTSW 4 105015866 missense probably benign 0.00
R1672:Fyb2 UTSW 4 104950862 missense probably benign 0.10
R1710:Fyb2 UTSW 4 105003916 missense probably damaging 1.00
R1900:Fyb2 UTSW 4 104945455 missense probably benign 0.06
R1965:Fyb2 UTSW 4 104913649 missense probably benign 0.00
R2106:Fyb2 UTSW 4 104945572 missense probably benign 0.01
R5191:Fyb2 UTSW 4 104995797 missense possibly damaging 0.88
R5236:Fyb2 UTSW 4 104948760 missense probably benign 0.00
R5277:Fyb2 UTSW 4 105015679 missense probably damaging 1.00
R5502:Fyb2 UTSW 4 104945324 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105013321 missense probably damaging 1.00
R5769:Fyb2 UTSW 4 105015644 missense probably damaging 1.00
R6167:Fyb2 UTSW 4 104945464 missense possibly damaging 0.46
R6169:Fyb2 UTSW 4 105000516 missense probably benign 0.16
R6371:Fyb2 UTSW 4 104995778 missense probably damaging 0.97
R6582:Fyb2 UTSW 4 104945542 missense probably benign 0.00
R6713:Fyb2 UTSW 4 104990235 missense probably benign 0.16
R6719:Fyb2 UTSW 4 105010459 missense probably benign 0.07
X0018:Fyb2 UTSW 4 104945210 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGCTTATCCAAGACCGTGCAGAC -3'
(R):5'- AGCTGGAGAAGTCCCACTTTCGTC -3'

Sequencing Primer
(F):5'- gagaggaaagaagggataaggg -3'
(R):5'- TAGAAAGATCATTAGCCTCCTGTGC -3'
Posted On2014-01-15