Incidental Mutation 'R1216:Exoc1'
ID99637
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Nameexocyst complex component 1
Synonyms2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76529311-76570294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76554188 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 445 (K445R)
Ref Sequence ENSEMBL: ENSMUSP00000109121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]
Predicted Effect probably benign
Transcript: ENSMUST00000049469
AA Change: K438R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435
AA Change: K438R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087133
AA Change: K438R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435
AA Change: K438R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113493
AA Change: K445R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435
AA Change: K445R

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202151
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 unclassified probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76567975 missense probably damaging 1.00
R4413:Exoc1 UTSW 5 76542019 intron probably benign
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4557:Exoc1 UTSW 5 76561443 missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R4677:Exoc1 UTSW 5 76559163 missense probably null 0.82
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76537779 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCTGCCACTCTGGTTCTCAGAC -3'
(R):5'- GCTTCTGCTGGACTGACACACTAC -3'

Sequencing Primer
(F):5'- CACGTAAGTATGATTGCTCGAC -3'
(R):5'- ACACTACAGAACCTAAGTGTGTG -3'
Posted On2014-01-15