Incidental Mutation 'R1216:Kcnj11'
ID99645
Institutional Source Beutler Lab
Gene Symbol Kcnj11
Ensembl Gene ENSMUSG00000096146
Gene Namepotassium inwardly rectifying channel, subfamily J, member 11
SynonymsKir6.2
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46093953-46100764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46099861 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 13 (V13L)
Ref Sequence ENSEMBL: ENSMUSP00000148249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000180081] [ENSMUST00000209291] [ENSMUST00000209881] [ENSMUST00000211674]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180081
SMART Domains Protein: ENSMUSP00000136002
Gene: ENSMUSG00000096146

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:IRK 36 360 4.9e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209291
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209863
Predicted Effect probably benign
Transcript: ENSMUST00000209881
AA Change: V13L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect probably benign
Transcript: ENSMUST00000210655
Predicted Effect probably benign
Transcript: ENSMUST00000210770
Predicted Effect probably benign
Transcript: ENSMUST00000211674
AA Change: V13L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and is found associated with the sulfonylurea receptor SUR. Mutations in this gene are a cause of familial persistent hyperinsulinemic hypoglycemia of infancy (PHHI), an autosomal recessive disorder characterized by unregulated insulin secretion. Defects in this gene may also contribute to autosomal dominant non-insulin-dependent diabetes mellitus type II (NIDDM), transient neonatal diabetes mellitus type 3 (TNDM3), and permanent neonatal diabetes mellitus (PNDM). Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired insulin secretion, mild glucose intolerance, reduced glucagon secretion in response to hypoglycemia, hypoxia-induced seizure susceptibility, and stress-induced arrhythmia and sudden death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Kcnj11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Kcnj11 APN 7 46098769 missense probably benign 0.02
IGL01767:Kcnj11 APN 7 46099065 missense probably benign 0.05
IGL01950:Kcnj11 APN 7 46099149 missense probably damaging 1.00
IGL02388:Kcnj11 APN 7 46099789 missense probably benign 0.22
R0019:Kcnj11 UTSW 7 46098939 missense probably benign 0.34
R0710:Kcnj11 UTSW 7 46099125 missense probably benign 0.00
R1819:Kcnj11 UTSW 7 46099156 missense probably benign
R2155:Kcnj11 UTSW 7 46099357 missense probably damaging 1.00
R3148:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R3498:Kcnj11 UTSW 7 46099602 missense probably damaging 1.00
R4128:Kcnj11 UTSW 7 46099719 missense probably damaging 1.00
R4766:Kcnj11 UTSW 7 46099816 missense probably benign
R4926:Kcnj11 UTSW 7 46099120 missense probably benign 0.00
R5680:Kcnj11 UTSW 7 46098808 missense probably benign
R5708:Kcnj11 UTSW 7 46099818 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAGCCCGACGATATTCTGCAC -3'
(R):5'- TGGTACAAGCTTAGGGTAACCTGAGG -3'

Sequencing Primer
(F):5'- CGACGATATTCTGCACAATGAG -3'
(R):5'- CTTAGGGTAACCTGAGGAGAGG -3'
Posted On2014-01-15