Incidental Mutation 'R1216:Prcp'
ID99647
Institutional Source Beutler Lab
Gene Symbol Prcp
Ensembl Gene ENSMUSG00000061119
Gene Nameprolylcarboxypeptidase (angiotensinase C)
Synonyms2510048K03Rik, 2610104A14Rik
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location92874470-92934583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92917746 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 222 (N222S)
Ref Sequence ENSEMBL: ENSMUSP00000075429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076052] [ENSMUST00000207594]
Predicted Effect probably benign
Transcript: ENSMUST00000076052
AA Change: N222S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075429
Gene: ENSMUSG00000061119
AA Change: N222S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Peptidase_S37 20 211 1.4e-4 PFAM
Pfam:Peptidase_S28 53 475 3.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207594
Meta Mutation Damage Score 0.1108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase S28 family of serine exopeptidases. The encoded preproprotein is proteolytically processed to generate the mature lysosomal prolylcarboxypeptidase. This enzyme cleaves C-terminal amino acids linked to proline in peptides such as angiotension II, III and des-Arg9-bradykinin. The cleavage occurs at acidic pH, but the enzyme activity is retained with some substrates at neutral pH. This enzyme has been shown to be an activator of the cell matrix-associated prekallikrein. The importance of angiotension II, one of the substrates of this enzyme, in regulating blood pressure and electrolyte balance suggests that this gene may be related to essential hypertension. A pseudogene of this gene has been identified on chromosome 2. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body length, weight, and fat pads with resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Prcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Prcp APN 7 92933099 missense probably benign 0.00
IGL01124:Prcp APN 7 92910208 missense probably benign 0.01
IGL01538:Prcp APN 7 92910213 missense probably benign 0.09
IGL02005:Prcp APN 7 92927824 missense probably benign 0.01
IGL02160:Prcp APN 7 92917761 missense probably benign 0.02
IGL02548:Prcp APN 7 92901174 missense probably damaging 0.98
R0140:Prcp UTSW 7 92928611 missense probably damaging 1.00
R0480:Prcp UTSW 7 92919082 missense probably damaging 1.00
R0989:Prcp UTSW 7 92910216 missense probably benign 0.04
R1596:Prcp UTSW 7 92917834 intron probably benign
R1823:Prcp UTSW 7 92928675 missense probably damaging 0.98
R2132:Prcp UTSW 7 92901280 missense probably benign 0.01
R2206:Prcp UTSW 7 92928612 missense probably damaging 1.00
R4761:Prcp UTSW 7 92917725 splice site probably null
R5000:Prcp UTSW 7 92919160 missense probably damaging 0.99
R5320:Prcp UTSW 7 92928635 missense probably benign 0.01
R5969:Prcp UTSW 7 92917766 missense probably benign 0.01
R6013:Prcp UTSW 7 92927768 missense possibly damaging 0.72
R6298:Prcp UTSW 7 92928633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- tctgctgagtcccCTCTAATCATCTTTG -3'
(R):5'- ACGATCACATACCATACTAACAGGCaca -3'

Sequencing Primer
(F):5'- ggacagacagacaggcaaac -3'
(R):5'- AGGCacatacataagacataaaaacc -3'
Posted On2014-01-15