Incidental Mutation 'R1216:Smpdl3a'
ID99653
Institutional Source Beutler Lab
Gene Symbol Smpdl3a
Ensembl Gene ENSMUSG00000019872
Gene Namesphingomyelin phosphodiesterase, acid-like 3A
SynonymsASM3A, 0610010C24Rik, ASML3A
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location57794335-57811830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57802479 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 126 (I126S)
Ref Sequence ENSEMBL: ENSMUSP00000020022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020022] [ENSMUST00000151623]
Predicted Effect probably null
Transcript: ENSMUST00000020022
AA Change: I126S

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020022
Gene: ENSMUSG00000019872
AA Change: I126S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Metallophos 35 294 1.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125076
Predicted Effect probably null
Transcript: ENSMUST00000151623
AA Change: I96S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Smpdl3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Smpdl3a APN 10 57807946 missense probably benign 0.01
IGL01530:Smpdl3a APN 10 57807893 missense probably damaging 1.00
IGL01936:Smpdl3a APN 10 57802434 missense probably damaging 1.00
IGL02342:Smpdl3a APN 10 57809180 splice site probably benign
IGL02372:Smpdl3a APN 10 57807515 missense probably benign 0.05
IGL02827:Smpdl3a APN 10 57802496 missense probably damaging 1.00
R0462:Smpdl3a UTSW 10 57794731 missense probably benign 0.07
R0658:Smpdl3a UTSW 10 57811240 missense probably damaging 0.99
R1502:Smpdl3a UTSW 10 57809091 missense probably damaging 1.00
R1559:Smpdl3a UTSW 10 57807492 missense probably damaging 0.99
R1807:Smpdl3a UTSW 10 57801022 missense probably damaging 0.99
R2872:Smpdl3a UTSW 10 57802530 missense possibly damaging 0.51
R2872:Smpdl3a UTSW 10 57802530 missense possibly damaging 0.51
R2877:Smpdl3a UTSW 10 57809085 missense probably damaging 1.00
R4799:Smpdl3a UTSW 10 57808015 missense probably damaging 1.00
R4814:Smpdl3a UTSW 10 57811241 missense probably damaging 1.00
R4916:Smpdl3a UTSW 10 57801031 missense probably damaging 1.00
R5137:Smpdl3a UTSW 10 57801067 missense possibly damaging 0.93
R5778:Smpdl3a UTSW 10 57801001 missense probably damaging 0.98
R5781:Smpdl3a UTSW 10 57807938 missense possibly damaging 0.78
R5917:Smpdl3a UTSW 10 57805558 splice site probably null
R6044:Smpdl3a UTSW 10 57811262 missense possibly damaging 0.82
R6773:Smpdl3a UTSW 10 57802437 missense probably damaging 0.99
R6863:Smpdl3a UTSW 10 57808011 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGATCCTGTGGAATAGGCAGTG -3'
(R):5'- CAGGAATGCTTCCTTATACGCCACC -3'

Sequencing Primer
(F):5'- gctcaaaccatcccttgcttc -3'
(R):5'- CCACTGTCATAACTCTGACACTG -3'
Posted On2014-01-15