Incidental Mutation 'R1216:Ints6'
ID99673
Institutional Source Beutler Lab
Gene Symbol Ints6
Ensembl Gene ENSMUSG00000035161
Gene Nameintegrator complex subunit 6
SynonymsDICE1, Notch2l, Ddx26, 2900075H24Rik
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1216 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location62676330-62761169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62707698 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 394 (D394E)
Ref Sequence ENSEMBL: ENSMUSP00000152954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053959] [ENSMUST00000223585]
Predicted Effect probably damaging
Transcript: ENSMUST00000053959
AA Change: D394E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086788
Gene: ENSMUSG00000035161
AA Change: D394E

DomainStartEndE-ValueType
VWA 1 158 4.11e-1 SMART
Blast:VWA 307 331 1e-7 BLAST
Blast:RRM_2 701 727 3e-8 BLAST
Pfam:INT_SG_DDX_CT_C 803 865 4e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223585
AA Change: D394E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225700
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. The protein encoded by this gene is a DEAD box protein that is part of a complex that interacts with the C-terminus of RNA polymerase II and is involved in 3' end processing of snRNAs. In addition, this gene is a candidate tumor suppressor and is located in the critical region of loss of heterozygosity (LOH). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Ints6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Ints6 APN 14 62703179 missense probably damaging 1.00
IGL00763:Ints6 APN 14 62700865 splice site probably benign
IGL01624:Ints6 APN 14 62696871 missense probably benign 0.07
IGL01721:Ints6 APN 14 62713739 missense probably damaging 0.96
IGL02146:Ints6 APN 14 62759260 missense possibly damaging 0.91
R0302:Ints6 UTSW 14 62709512 missense probably damaging 1.00
R0320:Ints6 UTSW 14 62707635 nonsense probably null
R0543:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R0554:Ints6 UTSW 14 62704751 missense possibly damaging 0.87
R0620:Ints6 UTSW 14 62696759 missense probably benign
R0960:Ints6 UTSW 14 62709566 missense probably benign 0.39
R1254:Ints6 UTSW 14 62716374 missense probably benign 0.27
R1296:Ints6 UTSW 14 62704903 splice site probably benign
R1548:Ints6 UTSW 14 62713692 missense probably damaging 1.00
R1944:Ints6 UTSW 14 62693640 missense probably benign 0.03
R2040:Ints6 UTSW 14 62713689 missense probably damaging 0.99
R2279:Ints6 UTSW 14 62704682 critical splice donor site probably null
R2844:Ints6 UTSW 14 62704826 missense probably damaging 0.97
R3107:Ints6 UTSW 14 62760592 missense possibly damaging 0.92
R3407:Ints6 UTSW 14 62696937 missense probably benign 0.00
R3895:Ints6 UTSW 14 62696611 missense probably damaging 1.00
R4608:Ints6 UTSW 14 62703229 missense probably damaging 1.00
R4903:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4964:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R4966:Ints6 UTSW 14 62702462 missense probably damaging 1.00
R5014:Ints6 UTSW 14 62760191 missense probably benign 0.00
R5369:Ints6 UTSW 14 62743935 missense probably damaging 1.00
R6478:Ints6 UTSW 14 62700786 missense probably benign 0.37
R7022:Ints6 UTSW 14 62714337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTGGCGACACAATATTCA -3'
(R):5'- CGTAAGAAAGCACAGCGCCTGTT -3'

Sequencing Primer
(F):5'- CTTGGCGACACAATATTCATATATTC -3'
(R):5'- AAGCACAGCGCCTGTTTTTAG -3'
Posted On2014-01-15