Incidental Mutation 'R1216:Gpr152'
ID99697
Institutional Source Beutler Lab
Gene Symbol Gpr152
Ensembl Gene ENSMUSG00000044724
Gene NameG protein-coupled receptor 152
SynonymsA930009H15Rik, LOC269053
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R1216 (G1)
Quality Score192
Status Validated
Chromosome19
Chromosomal Location4139799-4145738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4143555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 365 (V365D)
Ref Sequence ENSEMBL: ENSMUSP00000094062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025761] [ENSMUST00000096338]
Predicted Effect probably benign
Transcript: ENSMUST00000025761
SMART Domains Protein: ENSMUSP00000025761
Gene: ENSMUSG00000024842

DomainStartEndE-ValueType
low complexity region 45 67 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
EFh 129 157 1.08e-6 SMART
Blast:EFh 165 193 2e-7 BLAST
EFh 206 234 1.05e-4 SMART
EFh 243 271 1.55e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000096338
AA Change: V365D

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094062
Gene: ENSMUSG00000044724
AA Change: V365D

DomainStartEndE-ValueType
Pfam:7tm_1 47 295 7e-19 PFAM
low complexity region 347 361 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Guca1a A G 17: 47,395,712 probably benign Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Gpr152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Gpr152 APN 19 4143507 missense probably benign
IGL01400:Gpr152 APN 19 4143627 missense probably benign 0.33
IGL01538:Gpr152 APN 19 4142952 missense probably damaging 1.00
IGL02288:Gpr152 APN 19 4143695 missense probably benign
IGL02513:Gpr152 APN 19 4142844 missense probably damaging 1.00
IGL03335:Gpr152 APN 19 4143771 missense possibly damaging 0.69
R0318:Gpr152 UTSW 19 4143542 missense possibly damaging 0.73
R1936:Gpr152 UTSW 19 4142532 missense probably damaging 1.00
R2248:Gpr152 UTSW 19 4143806 missense probably benign 0.00
R3161:Gpr152 UTSW 19 4142714 missense probably benign 0.00
R4193:Gpr152 UTSW 19 4142907 missense probably damaging 1.00
R4719:Gpr152 UTSW 19 4143224 missense possibly damaging 0.92
R4852:Gpr152 UTSW 19 4143791 missense probably benign 0.00
R5014:Gpr152 UTSW 19 4143507 missense probably benign 0.00
R5381:Gpr152 UTSW 19 4142517 missense probably damaging 1.00
R5431:Gpr152 UTSW 19 4143747 missense probably benign 0.21
R5470:Gpr152 UTSW 19 4143129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACTGCTTGTAGGACCTGTTG -3'
(R):5'- AGGCTGGACCACAGACTTTGATTG -3'

Sequencing Primer
(F):5'- GGCCAAGACCATTTTGTCAG -3'
(R):5'- ATTGTGGTTGGGCTGAGG -3'
Posted On2014-01-15