Incidental Mutation 'R1217:Cfap57'
ID99725
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission 039286-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1217 (G1)
Quality Score174
Status Validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118606652 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 335 (S335P)
Ref Sequence ENSEMBL: ENSMUSP00000080592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071972
AA Change: S335P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: S335P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081921
AA Change: S335P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: S335P

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2a A T 10: 75,333,215 Y171F probably damaging Het
Agpat4 C T 17: 12,210,316 R152W probably damaging Het
Aldh1a2 A G 9: 71,281,682 N293D possibly damaging Het
Ash2l T C 8: 25,822,885 N441S probably damaging Het
Asrgl1 A T 19: 9,116,500 probably null Het
Capn3 C A 2: 120,486,421 S277* probably null Het
Ccdc114 C T 7: 45,942,758 probably benign Het
Ccp110 T C 7: 118,729,944 probably benign Het
Cdh17 T C 4: 11,799,676 V491A probably benign Het
Cep170b T C 12: 112,740,905 S362P probably damaging Het
Cmklr1 A T 5: 113,614,046 L298Q probably damaging Het
Col4a4 A T 1: 82,489,009 probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Cyp2d26 A G 15: 82,792,867 probably benign Het
Cyth3 T C 5: 143,702,820 Y240H probably damaging Het
Dhx9 G A 1: 153,458,363 T1017I probably damaging Het
Edar T C 10: 58,628,631 Y62C probably damaging Het
Esyt3 C T 9: 99,318,044 G699D possibly damaging Het
Fgb T C 3: 83,043,257 T397A probably damaging Het
Foxc1 C A 13: 31,808,685 A493E unknown Het
Gm8251 A T 1: 44,057,179 S1586R possibly damaging Het
Grid1 T C 14: 34,820,229 M1T probably null Het
Ipo4 T C 14: 55,634,359 K113R probably damaging Het
Kif21b A G 1: 136,152,376 E550G probably damaging Het
Krt1 T C 15: 101,848,981 K265E possibly damaging Het
Lmx1a G A 1: 167,791,399 R109H probably damaging Het
Mcm5 A G 8: 75,126,291 K677R probably benign Het
Metap1 A T 3: 138,475,030 L130* probably null Het
Mrgpra4 A G 7: 47,981,337 L172P probably benign Het
Mylip G A 13: 45,406,702 E205K probably damaging Het
Myo3b A C 2: 70,330,880 E1128A probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nlrp4d T C 7: 10,364,267 I823V probably benign Het
Rec114 A T 9: 58,665,820 probably benign Het
Rimbp2 C T 5: 128,788,287 A666T probably benign Het
Siva1 C T 12: 112,646,921 Q68* probably null Het
Slc22a27 T A 19: 7,926,668 I35F probably benign Het
Slco1a5 T A 6: 142,254,374 N228I probably damaging Het
St8sia4 G A 1: 95,653,739 R93C probably damaging Het
Tprg T C 16: 25,412,843 S190P probably damaging Het
Trpc6 A G 9: 8,658,286 probably null Het
Vmn2r70 C T 7: 85,559,061 C736Y probably damaging Het
Zfp629 C T 7: 127,612,744 probably benign Het
Zswim4 A G 8: 84,219,972 V685A possibly damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense not run
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TAGTAGGCAACGTCAAGGTGGCAC -3'
(R):5'- ATGCGGTCAGGAGTCTGAGCTAAG -3'

Sequencing Primer
(F):5'- GTACCAAGCTTTGCATGGAC -3'
(R):5'- TTTTGTGCCTTGGGCAGATC -3'
Posted On2014-01-15