Allele | tumormouse | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | intron | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 9 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 45,006,150 bp (GRCm38) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | G ⇒ T (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Cd3e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | CD3 antigen, epsilon polypeptide | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | CD3epsilon, CD3, T3e | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 44,910,038-44,920,925 bp (-) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the CD3-epsilon polypeptide, which together with CD3-gamma, -delta and -zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T-cell receptor-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The genes encoding the epsilon, gamma and delta polypeptides are located in the same cluster on chromosome 11. The epsilon polypeptide plays an essential role in T-cell development. Defects in this gene cause immunodeficiency. This gene has also been linked to a susceptibility to type I diabetes in women. [provided by RefSeq, Jul 2008] PHENOTYPE: Mice homozygous null for this mutation lack peripherial T cells and have a block of thymocyte development at the DN3 stage. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P22646 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
PDB Structure |
CD3 Epsilon and gamma Ectodomain Fragment Complex in Single-Chain Construct [SOLUTION NMR]
CD3 EPSILON AND DELTA ECTODOMAIN FRAGMENT COMPLEX IN SINGLE-CHAIN CONSTRUCT [SOLUTION NMR] Mouse CD3epsilon Cytoplasmic Tail [SOLUTION NMR] Crystal structure of mouse cd3epsilon in complex with antibody 2C11 Fab [X-RAY DIFFRACTION] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000099896 Gene: ENSMUSG00000032093
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(5) : Targeted, knock-out(4) Chemically induced(1) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 030345-UCD | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2018-11-30 7:55 AM by Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2007-09-13 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | The tumormouse phenotype was identified in a screen for allogeneic sterility. G3 mice with homozygous ENU-induced mutations were injected intraperitoneally with L-929 fibroblasts of C3H background in order to pre-immunize against C3H alloreactive determinants. One animal developed an intra-abdominal tumor consisting of L-929 cells. The mutant phenotype was termed tumormouse.
Further analysis revealed that tumormouse animals have very small thymi with abnormal structure and no peripheral T cells. tumormouse mutants have no CD4+CD8+ double positive (DP) T cells, and thymocyte development was found to be arrested at the CD44+CD25- double negative (DN) 3 stage. Compared to wild type, tumormouse thymocytes display increased levels of apoptosis. B cells, macrophages and NK cells are found at normal levels in the periphery in tumormouse animals.
Some tumormouse animals older than 9 months of age appear to experience epileptic-like seizures.
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation | The tumormouse mutation was mapped to Chromosome 9 and corresponds to a C to A transversion at position 330 of the Cd3e transcript, in exon 5 of 8 total exons.
313 GGCTACTACGTCTGCTACACACCAGCCTCAAAT
79 -G--Y--Y--V--C--Y--T--P--A--S--N-
The mutated nucleotide is indicated in red lettering, and creates a premature stop codon in place of tyrosine 84 resulting in deletion of 106 amino acids from the C terminus of the protein.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The cytoplasmic domain of CD3ε contains a basic amino acid-rich region (4), a proline-rich region (5), and an immunoreceptor tyrosine-based activation motif (ITAM) (6). These motifs mediate interactions with downstream signaling molecules.
The tumormouse mutation replaces tyrosine 84 with a premature stop codon and truncates the CD3ε chain in the extracellular domain of the protein. The truncation results in a CD3ε null animal.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | Cd3ε is expressed in immature thymocytes and T cells, and localizes to the plasma membrane.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | T cell receptors (TCRs) are responsible for recognition of MHC/antigen ligands, with their different specificities generated by rearrangement of germline V, D, and J segments during development. The complete TCR consists of a complex including TCR α/β or γ/δ chains, several invariant CD3 chains, and ζ chains (see allia) (7). CD3γ, CD3δ and CD3ε constitute the three types of CD3 chains, and combine to form TCRs with stoichiometry TCRαβ or TCRγδ /CD3γε/CD3δε/ζζ.
Development of thymocytes into mature T cells occurs in the thymus, where thymocytes follow a program of differentiation characterized by expression of distinct combinations of cell surface proteins including CD4, CD8, CD44 and CD25. The most immature thymocytes are CD4-CD8- double negative (DN). This group can be further subdivided into 4 groups that differentiate in the following order: CD44+CD25- (DN1) to CD44+CD25+ (DN2) to CD44-CD25+ (DN3) to CD44-CD25- (DN4). During this process, expression of pre-TCRα (pTα), TCRα, TCRβ and CD3 proteins is activated in temporal sequence to promote T cell development. Transcripts of all the CD3 chains are expressed from the earliest identifiable thymic precursor stage (8). Studies of CD3ε-deficient mice demonstrate that CD3ε specifically contributes to formation of a pre-TCR complex with TCRβ and pTα at the CD44-CD25+ DN3 stage, and these animals have no mature T cells (9-11). Interestingly, one group reported that CD3ε null thymocytes were severely, but not completely arrested at the DN3 stage, suggesting that expression of the other components of the pre-TCR may assemble a partial complex that can weakly induce transition out of the DN3 stage (11).
In addition to the signal transduction cascade mediated by Lck and Fyn, another independent pathway involving recruitment of Nck to CD3ε may activate TCR signaling (5;15). This type of activation involves a conformational change in CD3ε (16), exposing a proline-rich region where Nck binds. Little data on the nature of the conformational change is available. Interestingly, this method of TCR complex activation does not require TCR crosslinking or tyrosine phosphorylation.
Recent work identified interactions between the membrane-proximal basic amino acid-rich region of CD3ε and G-protein-coupled receptor kinase 2 (GRK2) in thymocytes, which may be regulated by T cell activation and chemokines (4).
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | As in other CD3ε mutants, thymocyte development arrests at the DN3 stage resulting in a complete lack of mature T cells in tumormouse mutants. The absence of mature T cells describes the condition of severe combined immunodeficiency (SCID). Several mechanisms causing SCID have been identified, including defective pre-TCR/TCR signaling. CD3ε mutations cause SCID in this way (17) (OMIM +186830). Likewise, mice deficient in VDJ recombination due to deletion of recombination activating gene-1 (Rag-1) (18) or Rag-2 (19) are devoid of T cells and contain only immature DN3 thymocytes. In addition, mutations in any of the components of DNA-dependent protein kinase (DNA-PK) (20-22), CD3δ (19) or Artemis, a DNA double-strand break repair protein (23), results in a lack of T cells. As in mice, CD3e mutations in humans lead to immunodeficiency (17), and patients with such mutations develop serious infections for which antibiotics are poorly effective (24).
The immune system, being capable of recognizing and destroying developing tumors, and controlling the tumorigenicity of cancer cells, plays a strong protective role against cancer. Tumors derived from immunodeficient Rag2-/- mice are more immunogenic than those derived from immunocompetent mice (25). NK cells recognize invading cells, and together with dendritic cells, prime and activate CD4+ and CD8+ T cells to eliminate neoplastic cells. Immunotherapy using antigen-specific splenocytes confers protection from established and subsequent tumor burdens in mice (26). Tumor development in the tumormouse mutant can likely be attributed to a deficiency in ability to reject foreign cells due to lack of T cells.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | Tumormouse genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
Primers for PCR amplification
Tumor(F): 5’- GGACACCTCTCTACCAAGCAAACCTCG -3’
Tumor(R): 5’- GGTAGTGGCCCTGAGTCTCTCTGGATG -3’
PCR program
1) 94°C 2:00
2) 94°C 0:30
3) 59°C 0:30
4) 68°C 1:00
5) repeat steps (2-4) 35X
6) 68°C 5:00
7) 4°C ∞
Primers for sequencing
Tumor_seq(F): 5’- CGACACCCAGCGATAAGTAACTTC -3’
Tumor_seq(R): 5’- TAGACAACTCCAGGCCACACCG -3’
The following sequence of 678 nucleotides (from Genbank genomic region NC_000075 for linear genomic sequence of Cd3e) is amplified:
7093 ggacacct ctctaccaag caaacctcga cacccagcga taagtaactt
7141 cctgtaatct agttgcctct cacagcacta atttggcatt tgtgaaactt ccctagagtt 7201 tccccttcaa tccccttccc ttttcttctt ttcccagaat acaaagtctc catctcagga 7261 accagtgtag agttgacgtg ccctctagac agtgacgaga acttaaaatg ggaaaaaaat 7321 ggccaagagc tgcctcagaa gcatgataag cacctggtgc tccaggattt ctcggaagtc 7381 gaggacagtg gctactacgt ctgctacaca ccagcctcaa ataaaaacac gtacttgtac 7441 ctgaaagctc gaggtaactc gggctcctcc caaatcagcc ttctcaagaa ccctatcatc 7501 tctcagctgc tcctgcactc caccccaggt tctccggggc cacacattca gtattttctg 7561 aaaaatagac tgcacggtgt ggcctggagt tgtctaggta attccattgg taccaggtgt 7621 acaacagcaa cttcccacag atgaaggctt gggtcacctg ccttgtaacg tacccagaat 7681 caaggcttac tactatcatg agttgatggg gtcacttatt cagagaccca ttttattaca 7741 aggacatcca gagagactca gggccactac c PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is highlighted in red.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Xin Du, Bruce Beutler |