Phenotypic Mutation 'currant' (pdf version)
Allelecurrant
Mutation Type missense
Chromosome10
Coordinate28,782,011 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Themis
Gene Name thymocyte selection associated
Synonym(s) Tsepa, Gasp, E430004N04Rik
Chromosomal Location 28,668,360-28,883,818 bp (+)
MGI Phenotype Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery.
Accession Number

NCBI RefSeq: NM_178666; MGI:2443552

Mapped Yes 
Amino Acid Change Arginine changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000060129]
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: R345G

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000056097)
Phenotypic Category decrease in CD4+ T cells, decrease in CD4+ T cells in CD3+ T cells, decrease in T cells, increase in CD44 MFI in CD4, increase in CD44 MFI in CD8, increase in CD8+ T cells in CD3+ T cells
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted(6) Gene trapped(2) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice donor site probably benign 0.00
IGL01729:Themis APN 10 28761591 nonsense probably null 0.00
IGL01833:Themis APN 10 28782311 nonsense probably null 0.00
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 splice site 0.00
cloudies UTSW 10 28761199 nonsense probably null
death_valley UTSW 10 28668727 missense probably damaging 1.00
R0445:Themis UTSW 10 28782011 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense probably benign 0.12
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense probably benign 0.43
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably benign 0.29
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2106:Themis UTSW 10 28761143 splice acceptor site probably benign
R2150:Themis UTSW 10 28668727 missense probably damaging 1.00
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign 0.00
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5054:Themis UTSW 10 28761237 missense noncoding transcript
R5249:Themis UTSW 10 28761199 nonsense probably null
R5446:Themis UTSW 10 28761345 missense noncoding transcript
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R5760:Themis UTSW 10 28761285 missense noncoding transcript
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 037492-MU
Last Updated 06/20/2017 3:53 PM by Katherine Timer
Record Created 07/15/2013 8:06 PM by Kuan-Wen Wang
Record Posted 07/24/2014
Phenotypic Description

Figure 1. The currant mice exhibited a decrease in CD4+ and CD8+ T cells. Abbreviations: B6, C57BL/6J; G3, G3 mice.

Figure 2. Currant mice exhibited a slight reduction in the T-dependent IgG response to aluminum hydroxide-emulsified ovalbumin (OVA-alum). Abbreviations: B6, C57BL/6J; G3, G3 mice.

Figure 3. Currant mice exhibited normal T-dependent (TD) IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). Abbreviations: B6, C57BL/6J; G3, G3 mice.
Figure 4. Currant mice exhibited normal T-independent (TI) IgM responses to 2,4,6-trinitrophenyl (NP)-Ficoll. Abbreviations: B6, C57BL/6J; G3, G3 mice.

The currant phenotype was identified among G3 mice of the pedigree R0445, some of which showed an increase in the B:T cell ratio, a decrease in the frequency of B1a cells, a decrease in the CD4+ to CD8+ T cell ratio caused by a diminished frequency of CD4+ T cells coupled with lesser diminution of CD8+ T cells, and an increase in the CD44 mean fluorescence intensity on both CD4+ and CD8+ T cells, all in the peripheral blood (Figure 1).  The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 2), while the response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal), another T-dependent antigen, was normal (Figure 3).  The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was normal (Figure 4). 

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 62 mutations.   All of the above anomalies were linked by continuous variable mapping to a mutation in Themis:  an A to G transition at base pair 28,782,011 (v38) on chromosome 10, or base pair 113,685 in the GenBank genomic region NC_000076 encoding Themis.  The strongest association was found with a recessive model of linkage to the normalized B:T ratio, wherein six variant homozygotes departed phenotypically from 10 homozygous reference mice and 11 heterozygous mice with a P value of 2.49 x 10-13.  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed.  The mutation corresponds to residue 1,298 in the mRNA sequence NM_178666 within exon 4 of 6 total exons.

 

1283 AAAGGCAAGTTCAAAAGAAGACCACGGGAGTTC

340  -K--G--K--F--K--R--R--P--R--E--F-

 

The mutated nucleotide is indicated in red.  The mutation results in an arginine (R) to glycine (G) substitution at position 345 (R345G) in the Themis protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction
Figure 5. Domain structure of Themis. The currant mutation (R345G) is shown. Abbreviations: CABIT, cysteine-containing all beta in Themis; NLS, nuclear localization signal; PRR, proline-rich region. See text for more details.

Thymocyte expressed molecule involved in selection [Themis; alternatively, Grb2-associating protein (Gasp)] is a highly conserved member of a recently identified gene family that includes Themis2 (alternatively, ICB-1) and Themis3 (alternatively, 9130404H23Rik) (1-3). Themis is thymocyte-specific, while Themis2 is B cell- and macrophage-specific and Themis3 is expressed primarily in the intestine (1;3;4). Themis and Themis2 share 29% identity and 65% similarity at the amino acid level and have similar functions in T and B cells, respectively (the functions of Themis are described in the “Background” section) (5). All of the members of the Themis protein family contain two CABIT (cysteine-containing all beta in Themis) domains (amino acids 1-261 (CABIT1) and 262-521 (CABIT2) in Themis), a bipartite nuclear localization signal (NLS; amino acids 345-349 in Themis), and a proline-rich region (PRR; PPPRPPKHP; amino acids 555-563 in Themis) [Figure 5; (1;2;4-6); reviewed in (7)].

 

The CABIT domain is a globular domain that is predicted to fold in an all β-strand structure with at least 12 strands forming a β-sandwich-like fold or a dyad of 6-stranded β-barrel units (4). In the middle of the CABIT1 domain of Themis is a cysteine residue (Cys153 in mouse Themis) nearly absolutely conserved among the Themis protein family that is likely exposed as it occurs at the end of a predicted β-strand (4). Other conserved residues, including a motif surrounding the cysteine residue (ϕXCX7-26ϕXLPϕX3GXF; X = any amino acid and ϕ = any hydrophobic residue), are either hydrophobic residues that form the cores of strands, or polar residues that mark the turns between strands (4). The two CABIT domains in Themis have distinct functions, but both are required for positive selection of developing thymocytes (6). The highly conserved cysteine-rich core motif of the CABIT1 domain (Core1; amino acids 150-174), along with the NLS, is essential for the nuclear localization of Themis, but the core motif of the CABIT2 domain (Core2; amino acids 411-434) is not (6).  Transgenic expression of a CABIT1 core domain-deletion mutant (ΔCore1-Themis) on a Themis-/- genetic background resulted in a dominant negative-type inhibition of T cell development (6). The ΔCore1-Themis transgenic mice exhibited decreased numbers of T cell subsets (e.g., thymic double-positive (DP) cells and post-selected (CD69+, T cell receptor (TCR)hi) DP thymocytes) compared to Themis-/- mice (6). A ΔCore2-Themis mutant did not confer dominant-negative inhibition of T cell development when expressed transgenically (6).

 

The NLS of Themis is within the second CABIT domain. The NLS mediates nuclear importation and retention of Themis (1;5). Further studies determined that both the NLS and the Core1 domain are required for Themis nuclear localization; the Core2 and the PRR domains are not (6). Transgenic expression of an NLS-deletion mutant (ΔNLS-Themis) on a Themis-/- genetic background resulted in some recovery of CD4 single positive (SP; CD4+CD8-) thymocytes in the periphery, indicating a less detrimental effect on positive selection in the thymus compared to other Themis mutants (e.g., ΔCore1-Themis) (6).

 

Paster et al. proposed that Themis folds into a global compact structure and that the PRR motif and/or its surrounding region are connected to a distal region of Themis (8). The PRR contains three overlapping PXXP putative SH3 domain recognition motifs that mediate the constitutive association of Themis with growth factor receptor–bound protein 2 (Grb2), an adaptor protein that associates with several cell surface receptors (e.g., epidermal growth factor receptor (EGFR; see the record for Velvet) and insulin receptor) to propagate downstream signaling (1-3;8;9). The PRR domain of Themis mediates interactions with other signaling proteins including IL-2-inducible T cell kinase (Itk) (3), phospholipase C [PLCγ1; (see the record for queen)], SHP1 (see the record for spin), Src homology (SH) 2 domain-containing leukocyte protein of 76 kDa (SLP-76), and SOS1 (son of sevenless homolog) upon TCR engagement (1-5;8-11). In TCR-associated signaling, Themis interacts with linker for activation of T cells (LAT) through Grb2 (see “Background” for more details on TCR-associated signaling). Themis requires constitutive association with Grb2 to permit LAT-dependent recruitment of Themis to the immunological synapse upon TCR stimulation and the subsequent phosphorylation of Themis by lymphocyte protein tyrosine kinase (Lck; see the record for iconoclast) and zeta-chain (TCR)-associated protein kinase (ZAP70; see the record for murdock) (8). In addition to mediating interactions with SH3-containin proteins, the PRR is proposed to facilitate the localization of Themis to the plasma membrane (4;8). The importance of the PRR has been demonstrated in vivo (6;8).  Lethally irradiated recipient mice reconstituted with Themis-/- bone marrow cells retrovirally transduced with a Themis PRR mutant (ThemisPro557/560Ala) exhibited a reduction in CD4 SP thymocytes and peripheral T cells compared to recipient mice reconstituted with wild type Themis-expressing bone marrow cells (8). In a transgenic mouse expressing a PRR deletion mutant (ΔPRS-Themis) on a Themis-/- genetic background, peripheral CD4 SP cells were recovered, although there was defective positive selection in the thymus, indicating that the PRR domain may not be necessary for peripheral expansion and/or survival of mature T cells, but it is required for positive selection (6).

 

Within 30 seconds after TCR stimulation in both Jurkat and human T cells, Themis is tyrosine phosphorylated (1;3;6;8;9); the two major sites (Tyr542 and Tyr543 in mouse; Tyr540 and 541 in human) are within a YY-motif upstream of the PRR (8). Three major kinases, Lck, Zap70, and Itk, regulate tyrosine phosphorylation during the early phases of TCR signaling. Treatment of Jurkat T cells with the Itk inhibitor BMS-509744 determined that Itk was not involved in Themis phosphorylation, however, both Lck and ZAP70 induced Themis phosphorylation (8). Other studies determined that in HEK293T cells, Lck or Fyn phosphorylated Themis, but not Zap70 (5). Exogenous expression of a human phosphorylation-deficient mutant (Tyr540/541Phe) in Jurkat cells resulted in the loss of Grb2 association and the mutant no longer bound to LAT (8). In HEK293 cells, Themis-Grb2 association was not altered in response to increasingly phosphorylated Themis (8). Mouse Themis containing mutations of Tyr542 and Tyr543 (muTHEMIS-Tyr542/543Phe) failed to support normal T cell development when retrovirally transduced in Themis-/- bone marrow cells used to reconstitute lethally irradiated B6.SJL recipient mice (8). Paster et al. proposed that phosphorylation of Themis may facilitate a conformational change in the CABIT domain region, possibly into an active form of the protein (8).

 

The Themis mutation (R345G) is within the CABIT2 domain and is also within the NLS of Themis.

Expression/Localization

Themis is expressed exclusively in lymphoid tissues (2;12). Themis expression is high in the thymus and is lower in the spleen; Themis expression was not detected in bone marrow (1;3;13). Themis is expressed in all thymocyte subsets, including CD4 and CD8 SP αβ T, γδ T, and Treg cells; Themis is not expressed in B cells or natural killer (NK) cells (1;3); Themis expression was slightly higher in CD8 SP than CD4 SP cells (2). In T cells, Themis is expressed at high levels between the pre-TCR and positive selection checkpoints, but it is downregulated after positive selection resulting in low expression in mature T cells (1-4;8;13).

 

Themis localizes to both the nucleus and cytosol (1;3;4;6;10). Upon TCR stimulation, cytoplasmic Themis is recruited to the T cell-APC interface in a Grb2-dependent manner via its interaction with Lat (8).

 

The expression and localization of Themiscurrant has not been examined.

Background
Figure 6. Development of T cells within the thymus gland. CD4+ and CD8+ T cells expressing αβ T-cell receptors (TCR) begin their development as double negative CD4-CD8- precursor thymocytes in the capsule of the thymus.  After TCRβ rearrangement, progression to the double positive CD4+CD8+ stage, and TCRα rearrangement (in the cortex of the thymus), the yet immature TCRαβ+CD4+CD8+ thymocytes are then subject to positive or negative selection to generate mature CD4+ helper T cells and CD8+ cytotoxic T cells in the medulla of the thymus.
Figure 7. TCR signaling pathway. TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of antigen presenting cells (APCs).  Binding of these ligands to the TCR initiates signaling and T cell activation. The TCR is composed of two separate peptide chains (TCRα/β), and is complexed with a CD3 heterodimer (CD3εγ or CD3εδ) and a ζ homodimer. One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex. Lck and Fyn are regulated by the phosphorylation of two key tyrosine residues, an activating tyrosine located in the activation loop, and an inhibitory tyrosine located in the C-terminal tail.  CD45 dephosphorylates the C-terminal inhibitory tyrosine, thereby promoting the activation of Lck and Fyn. Once activated, they phosphorylate ITAMS present on the CD3 and ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP-70 and Syk, which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. The Syk family kinases phosphorylate LAT and SLP-76. LAT binds to the adaptor proteins growth factor receptor-bound 2(Grb2), Src homologous and collagen (Shc) and GRB2-related adaptor downstream of Shc (Gads), as well as phosphatidylinositol 3-kinase (PI3K) and PLC-γ1.  SLP-76 is then recruited to the complex via Gads and binds the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), IL-2-induced tyrosine kinase (Itk), PLC-γ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1).  This proximal signaling complex is required for PLC-γ1-dependent pathways including calcium (Ca2+) mobilization and diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways.  Activated PLC-γ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase Cθ and Ras, respectively.  PKCθ regulates nuclear factor-κB activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1), and caspase recruitment domain family, member 11 (CARMA1). Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors. Figure is interactive.

Themis and T cell development

CD4+ and CD8+ T cells expressing αβ TCRs begin their development as double negative (DN; CD4-CD8-) precursor thymocytes (Figure 6). Differentiation proceeds through several stages known as DN1-4. Progression and expansion past DN3 (CD44-CD25+) requires surface expression of the product of a chromosomally rearranged TCRβ chain, which pairs with an invariant pre-TCRα chain and then forms a complex with a CD3 heterodimer (CD3εγ or CD3εδ; see the record for tumormouse) and a CD3 zeta (ζ) homodimer (see the record for allia) (14).  This complex, known as the pre-TCR, produces a TCR-like signal that is necessary for continued survival as well as the expansion of cell numbers and continued differentiation to the double positive (DP; CD4+CD8+) stage; TCR-associated signaling is described in more detail, below (15;16). After TCRβ rearrangement, progression to the DP stage, and TCRα rearrangement, the yet immature TCRαβ+CD4+CD8+ thymocytes are then subjected to positive or negative selection to generate mature CD4+ helper T cells and CD8+ cytotoxic T cells. The affinity and avidity of T cell-stromal cell interactions determines the outcome of thymic selection, with high affinity TCR-self-MHC interactions leading to elimination of the T cell (negative selection), and low affinity TCR-self-MHC interactions promoting T cell survival (positive selection) to become SP CD4+CD8- or CD8+CD4- T cells. For a detailed description of T cell development, please see the record for thoth.

 

Themis functions at the positive selection checkpoint in thymocyte development; its mode of action is not known (1-4;10). Fu et al. examined the function of Themis in positive selection in OT-1-Tap1-/- mice, which exhibit arrested thymocyte development at the pre-selection DP stage (11). OT-1-Tap-/-Themis-/- thymocytes exhibited stronger TCR responses to low-affinity MHC-peptide ligands (the function of Themis is masked in response to high-affinity ligands) than OT-1-Tap-/-Themis+/+ thymocytes (11). In OT-1-Tap-/-Themis-/- DP thymocytes, ERK signaling was faster and stronger than in OT-1-Tap-/-Themis+/+ DP thymocytes in response to ligands weaker than Kb–OVA (11). In OT-1-Tap-/-Themis-/- pre-selection thymocytes, levels of LAT, SHP1, and PLCγ1, but not SLP-76, phosphorylation were elevated compared to wild-type cells in response to low-affinity ligands (11). Caspase-3 activation was induced in the OT-1-Tap-/-Themis-/- pre-selection thymocytes in response to ligands that induced positive selection, but the levels were normal in response to ligands that induced negative selection (11). Fu et al. proposed that Themis limits the TCR signal strength through a control of SHP1 activation, regulating the strength and kinetics of responses to low-affinity ligands (11). Upon the loss of Themis expression, thymocytes receive strong agonist/negative-selection-like signals when stimulated by weak agonists classically known as positive-selecting ligands (11).

 

Several Themis mutant mouse strains exhibited a block in positive selection, resulting in a block in the developmental progression from DP to SP cells (1-5;8;10). As a result, the mutant mice exhibited reduced numbers of thymic and peripheral CD4 and CD8 SP cells; the CD4 SP cells were more affected than the CD8 SP cell population (1-5;8;10). Thymocytes from a Themis knockout model, Themistm1Lov (MGI:4353254), initiated, but did not complete, positive selection (1). In another Themis knockout mouse, Themistm1Gasc (MGI:4353091), immature TCRloCD69lo cells (DN and DP cells) were found at similar levels to those in wild-type mice, but TCRintCD69lo cells (pre-selection DP cells) were at slightly higher proportions in the Themistm1Gasc mice compared to wild-type mice (3). TCRhiCD69hi cells (post-positive selection thymocytes; CD4 or CD8 SP cells) were depleted in the Themistm1Gasc thymus (3). The Long-Evans Cinnamon (LEC) rat model exhibited defects in the development of SP T cells from DP cells, a phenotype referred to as T-helper immunodeficiency (thid) (17;18). Within the Thid locus, a contiguous deletion of the Ptprk and Themis genes results in the loss of expression of both genes (17). Transplantation of LEC rat-derived bone marrow cells transduced with a lentiviral vector expressing Themis into X-irradiated recipient LEC rats rescued CD4 SP cell development (17).

 

The role of Themis in negative selection is unclear. In several mutant mouse studies, minor defects in negative selection were observed along with defects in positive selection (1;3). Negative selection occurred upon the loss of Themis in homozygous Themistm1Lov mice, however, it was not as efficient (1). Staphylococcus enterotoxin B superantigen-induced deletion of Vβ8+ CD4 SP cells was impaired upon the loss of Themis, indicating that Themis is necessary for late negative selection of CD4 SP thymocytes (1). Fu et al. observed a defect in both positive and negative selection in the Themistm1Gasc mice, indicating a general defect in TCR-associated signaling (3). Additional studies did not observe a defect in negative selection in Themis mutant mice (2;4).

 

Themis and TCR-associated signaling

TCR signaling is essential for thymocyte differentiation, T cell activation, and T cell homeostasis [reviewed in (19;20)].  TCRs are responsible for the recognition of major histocompatibility complex (MHC) class I and II, as well as other antigens found on the surface of APCs (Figure 7).  One of the first steps in TCR signaling is the recruitment of the tyrosine kinases Lck and Fyn to the receptor complex where they phosphorylate immunoreceptor tyrosine-based activation motifs (ITAMs) in the CD3εγ/δ and CD3ζ chains. Phosphorylation of the ITAM motifs results in recruitment of ZAP70 and Syk (see the record for poppy), which trans- and auto-phosphorylate to form binding sites for SH2 domain- and protein tyrosine binding domain-containing proteins. Syk subsequently phosphorylates LAT and SLP-76, which serve as docking sites for downstream effector molecules. LAT binds to Grb2, Src homologous and collagen (Shc), phosphatidylinositol 3-kinase (PI3K), and PLCγ1, and GRB2-related adaptor downstream of Shc (Gads) (21;22)­­. Gads-mediated recruitment of SLP-76 facilitates the formation of a proximal signaling complex composed of the guanine nucleotide exchange factor Vav1, Nck (non-catalytic region of tyrosine kinase adaptor protein), Itk, PLCγ1, adhesion and degranulation-promoting adaptor protein (ADAP), and hematopoietic progenitor kinase 1 (HPK1) that is required for PLCγ1-dependent pathways including calcium (Ca2+) mobilization, diacylglycerol (DAG)-induced responses, cytoskeleton rearrangements, and integrin activation pathways. Activated PLCγ1 hydrolyzes the membrane lipid phosphatidylinositol-3,4-diphosphate (PIP2) to inositol-1,4,5-trisphosphate (IP3) and DAG resulting in Ca2+-dependent signal transduction including activation of nuclear factor of activated T cells (NF-AT), and activation of protein kinase C theta (PKCθ; please see the record for Untied) and Ras, respectively. PKCθ regulates nuclear factor-κB (NF-κB; see the records for panr2, xander, and finlay) activation via the trimolecular complex composed of Bcl10, mucosa-associated lymphoid tissue translocation gene 1 (MALT1 or paracaspase), and caspase recruitment domain family, member 11 (CARMA1 or CARD11; see the record for king). In its GTP-bound active state, Ras initiates a mitogen-associated protein kinase (MAPK) phosphorylation cascade culminating in the activation of various transcription factors [reviewed by (23)].

 

The function of Themis in TCR signaling has not been resolved. Studies have reported a constitutive association of Themis with TCR signaling proteins including Vav1 (1), Itk, and PLCγ1 (3;8;9). In addition, several studies determined that, upon TCR stimulation, Themis associated with PLCγ1, LAT, and SLP-76 indicating that Themis may be a component of the SLP-76/LAT signalosome (1;3;6;8;9). In Themis-knockdown Jurkat cells TCR-dependent ERK and NF-AT activation as well as IL-2 levels were reduced after anti-CD3/CD28 stimulation (9). Another study observed delayed Erk1 phosphorylation and reduced Erk2 phosphorylation in Themis-deficient DP thymocytes after anti-CD3/CD4 stimulation; ZAP70, PLCγ1, Itk, LAT, Raf, MEK, and Jnk phosphorylation were not affected by loss of Themis expression (3). Lesourne et al. observed reduced TCR-dependent activation of ERK1/2, p38, and Vav1 in Themis-deficient CD4 and CD8 SP thymocytes after anti-CD3/CD4 stimulation (1;5). In contrast, in other studies using DP thymocytes from Themis-deficient mice, ERK and calcium influx were not changed compared to wild type thymocytes upon anti-CD3/CD4 TCR stimulation (1;2). Themis-deficient DP thymocytes exhibited comparable expression of activation markers (e.g., CD2, CD24, CD5, and CD69) to wild-type DP thymocytes upon anti-CD3/CD4 TCR stimulation (1). Okada et al. proposed that the apparent discrepancies between the above-mentioned studies may be due to different experimental systems (i.e., different cell types and/or mode of TCR stimulation) (6).

 

Treg function & intestinal inflammation

Inflammatory bowel disease (IBD) is a chronically recurring inflammatory disorder of the intestine, with clinical signs that can include diarrhea, abdominal pain, rectal bleeding, fever, weight loss, and signs of malnutrition (24). A spontaneous four-nucleotide insertion in the rat Themis gene resulting in coding of a premature stop codon was identified in a Brown-Norway rat colony [BN mutated (BNm)] (25). The Themis mutation resulted in T cell lymphopenia and was associated with the development of IBD (25). The BNm rats exhibited reduced absolute numbers of CD4 Treg cells in the thymus, spleen, and lymph nodes as well as reduced activity of peripheral and thymic CD4+CD25bright Treg cells, which are essential in the control of autoimmunity (25). In the BNm rats, the levels of Th17-Th2 cytokines and IFN-γ were reduced compared to wild-type BN rats (25). Taken together, in the BN rat, Themis is essential for the development of Treg cells and defects in Themis-dependent Treg function are linked to the development of IBD (25). In the mouse, mutations in Themis resulted in increased frequency of CD4+ Treg cells, but absolute numbers of Treg cells were reduced compared to wild-type mice (3). Themis-deficient mice do not exhibit symptoms of IBD (6).

 

Mutations in the noncoding region between THEMIS and PTPRK have been linked to susceptibility to celiac disease in humans (26). In addition, patients with celiac disease exhibit elevated THEMIS levels in the duodenal mucosa compared to unaffected individuals (12).

Putative Mechanism

Mice with mutations or deficiency in Themis phenocopy the currant mice in that all of the models exhibit reduced frequencies of peripheral CD4 and CD8 SP cells compared to wild-type mice (1-4;10), suggesting that the currant mutation is hypomorphic.  Thymocyte positive selection is likely defective in currant mice, as shown for other Themis mutants.

 

The numbers of B cells, natural killer (NK) cells, dendritic cells, and granulocytes in the central and peripheral lymphoid organs were comparable between Themis mutant and wild-type mice (1;4;10). In an ENU-induced mutant, Themis5AT161, CD4+Foxp3+ cells were decreased to a greater extent than conventional CD4 SP cells; NKT and γδ T cells were unaffected (4).  In addition, the Themis5AT161 mice exhibited anti-nuclear autoantibodies, low anti-CD3ε+CD28-induced proliferation, and a decreased percentage of naive CD44low CD4+ T cells in the blood (4). These phenotypes were not examined in currant mice.

Primers PCR Primer
currant(F):5'- TTCAGTTGCTGTCTACGGACGACC -3'
currant(R):5'- CCTGACTTGAAGTAGCCCTGCATC -3'

Sequencing Primer
currant_seq(F):5'- CGGACGACCTTTTTGAAATGACC -3'
currant_seq(R):5'- AGGAAGCTGTGCATCTTCAC -3'
Genotyping

Currant genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Currant(F): 5’- TTCAGTTGCTGTCTACGGACGACC-3’

Currant(R): 5’- CCTGACTTGAAGTAGCCCTGCATC-3’

 

Sequencing Primer

Currant_seq(F): 5’- CGGACGACCTTTTTGAAATGACC-3’
 

Currant_seq(F): 5’- AGGAAGCTGTGCATCTTCAC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 797 nucleotides (from Genbank genomic region NC_000076 for the linear DNA sequence of Themis) is amplified:

 

113449                                                     tt cagttgctgt   

113461 ctacggacga cctttttgaa atgaccagca aagagtttcc tgtagtagct gaagttgtcg   

113521 aaatatctca agggaaccac ctgccccaaa gtattttgca gcgagagaaa accattgtca   

113581 tccacaaaaa gtaccaggct tcgaggatct tagcttcaga aattcgcagc aatttcccta   

113641 aaagacactt cttgatccct attagctaca aaggcaagtt caaaagaaga ccacgggagt   

113701 tccccacggc ctatgacctg cagatagcta agagcaggaa agaaactctc cacgtggtgg   

113761 ccaccaaagc tttccataca cttcacaagg agctgtcccc tgtgtctgtt ggagaccagt   

113821 ttctagtgca tcattcagag accacagaag ttgtctttga ggggacaaga aaagtaaacg   

113881 ttctgacctg tgaaaaagtc ctcaataaga cccgtgaaga tgcacagctt cctctataca   

113941 tggaaggagg ttttgtagag gtgattcatg ataagaaaca gtatcagatt tccgagctct   

114001 gtacccagtt ttgctggccc ttcaatgtga aggtggctgt gagagatctc tccattaaag   

114061 atgacatttt ggcagctacc ccaggacttc agttagagga ggacatcaca gattcttatc   

114121 tacttatcag tgactttgca aatcctgagg aatgttggga aattcccatg agccgcttga   

114181 atatgactgt tcgactagtt aatggtagca gtttgcctgc agatgcaggg ctacttcaag   

114241 tcagg

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
  26. Dubois, P. C., Trynka, G., Franke, L., Hunt, K. A., Romanos, J., Curtotti, A., Zhernakova, A., Heap, G. A., Adany, R., Aromaa, A., Bardella, M. T., van den Berg, L. H., Bockett, N. A., de la Concha, E. G., Dema, B., Fehrmann, R. S., Fernandez-Arquero, M., Fiatal, S., Grandone, E., Green, P. M., Groen, H. J., Gwilliam, R., Houwen, R. H., Hunt, S. E., Kaukinen, K., Kelleher, D., Korponay-Szabo, I., Kurppa, K., MacMathuna, P., Maki, M., Mazzilli, M. C., McCann, O. T., Mearin, M. L., Mein, C. A., Mirza, M. M., Mistry, V., Mora, B., Morley, K. I., Mulder, C. J., Murray, J. A., Nunez, C., Oosterom, E., Ophoff, R. A., Polanco, I., Peltonen, L., Platteel, M., Rybak, A., Salomaa, V., Schweizer, J. J., Sperandeo, M. P., Tack, G. J., Turner, G., Veldink, J. H., Verbeek, W. H., Weersma, R. K., Wolters, V. M., Urcelay, E., Cukrowska, B., Greco, L., Neuhausen, S. L., McManus, R., Barisani, D., Deloukas, P., Barrett, J. C., Saavalainen, P., Wijmenga, C., and van Heel, D. A. (2010) Multiple Common Variants for Celiac Disease Influencing Immune Gene Expression. Nat Genet. 42, 295-302.
Science Writers Anne Murray
Illustrators Diantha La Vine, Peter Jurek
AuthorsKuan-Wen Wang, Ming Zeng, Jin Huk Choi, Bruce Beutler