Phenotypic Mutation 'screamer' (pdf version)
Allelescreamer
Mutation Type nonsense
Chromosome16
Coordinate15,831,282 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Prkdc
Gene Name protein kinase, DNA activated, catalytic polypeptide
Synonym(s) slip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
Chromosomal Location 15,637,866-15,842,235 bp (+)
MGI Phenotype Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer.
Accession Number

NCBI RefSeq: NM_011159; MGI:104779

Mapped Yes 
Amino Acid Change Glycine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000023352]
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672
AA Change: G3707*

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Predicted Effect probably null
Phenotypic Category decrease in B cells, decrease in B1a cells, decrease in B2 cells, decrease in B220 MFI in B cells, decrease in CD4+ T cells, decrease in CD8+ T cells, decrease in CD8+ T cells in CD3+ T cells, decrease in IgD MFI in B cells, decrease in IgD+ B cells, decrease in IgM+ B cells, decrease in T cells, increase in B1 cells, increase in CD4:CD8, increase in CD44 MFI in CD8, increase in CD44 MFI in T cells, increase in CD44+ CD4 T cells, increase in macrophages, increase in neutrophils, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV, T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All alleles(28) : Targeted(4) Gene trapped(17) Transgenic(1) Spontaneous(2) Chemically induced(3) QTL(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense possibly damaging 0.94
IGL00225:Prkdc APN 16 15809644 missense probably benign 0.35
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.10
IGL00488:Prkdc APN 16 15775847 splice acceptor site probably null 0.00
IGL00489:Prkdc APN 16 15799926 missense probably benign 0.06
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice donor site probably benign 0.00
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.09
IGL00708:Prkdc APN 16 15779426 missense probably benign 0.06
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.04
IGL00818:Prkdc APN 16 15759754 missense probably benign 0.36
IGL00917:Prkdc APN 16 15739564 missense possibly damaging 0.90
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.00
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.00
IGL01141:Prkdc APN 16 15726704 missense probably benign 0.27
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign 0.00
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null 0.00
IGL01419:Prkdc APN 16 15835166 missense possibly damaging 0.94
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.04
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.00
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.51
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense probably benign 0.09
IGL01930:Prkdc APN 16 15698887 missense probably damaging 0.99
IGL01984:Prkdc APN 16 15708779 missense probably benign 0.00
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.02
IGL02152:Prkdc APN 16 15669285 missense probably damaging 0.97
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.00
IGL02336:Prkdc APN 16 15785978 missense probably benign 0.00
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.00
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.22
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.02
IGL02500:Prkdc APN 16 15714282 splice site 0.00
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense probably benign 0.42
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense probably benign 0.04
IGL02685:Prkdc APN 16 15836043 missense probably benign 0.09
IGL02741:Prkdc APN 16 15752726 splice site 0.00
IGL02803:Prkdc APN 16 15833666 splice site 0.00
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null 0.00
IGL02989:Prkdc APN 16 15800016 missense probably benign 0.17
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.00
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.00
IGL03091:Prkdc APN 16 15705310 splice site 0.00
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.00
IGL03128:Prkdc APN 16 15700744 splice site 0.00
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.00
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.00
IGL03390:Prkdc APN 16 15670626 nonsense probably null 0.00
clover UTSW 16 15702157 critical splice donor site
Screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign 0.00
screamer6 UTSW 16 15759605 missense probably damaging 1.00
Screamer7 UTSW 16 15654817 splice acceptor site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice acceptor site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0325:Prkdc UTSW 16 15810702 splice acceptor site probably benign
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0383:Prkdc UTSW 16 15795146 splice donor site probably benign
R0408:Prkdc UTSW 16 15684255 splice donor site probably benign
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0919:Prkdc UTSW 16 15667575 splice acceptor site probably benign
R0965:Prkdc UTSW 16 15829716 missense probably benign 0.00
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice donor site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1449:Prkdc UTSW 16 15648877 splice acceptor site probably benign
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign 0.00
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1616:Prkdc UTSW 16 15808028 splice acceptor site probably benign
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign 0.00
R1747:Prkdc UTSW 16 15785901 splice acceptor site probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign 0.00
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice acceptor site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice acceptor site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2164:Prkdc UTSW 16 15705207 missense probably damaging 1.00
R2165:Prkdc UTSW 16 15687348 splice acceptor site probably benign
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2271:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2272:Prkdc UTSW 16 15654817 splice acceptor site probably null
R2280:Prkdc UTSW 16 15725471 splice donor site probably benign
R2356:Prkdc UTSW 16 15684204 missense probably benign 0.00
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 unclassified probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4415:Prkdc UTSW 16 15648757 missense noncoding transcript
R4416:Prkdc UTSW 16 15648757 missense noncoding transcript
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4720:Prkdc UTSW 16 15667715 nonsense probably null
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5012:Prkdc UTSW 16 15654731 missense noncoding transcript
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5074:Prkdc UTSW 16 15772048 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5215:Prkdc UTSW 16 15772121 missense possibly damaging 0.64
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
R6120:Prkdc UTSW 16 15739471 missense probably benign 0.00
X0023:Prkdc UTSW 16 15740278 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
MMRRC Submission 038256-MU
Last Updated 01/05/2017 2:57 PM by Katherine Timer
Record Created 07/20/2013 1:15 PM by Kuan-Wen Wang
Record Posted 01/30/2014
Phenotypic Description
Figure 1. Homozygous screamer mice exhibit diminished T-dependent IgG responses to aluminum hydroxide (alum)-emulsified ovalbumin (OVA). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous screamer mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous screamer mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Screamer mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Screamer mice exhibit decreased frequencies of peripheral B2 cells. Flow cytometric analysis of peripheral blood was utilized to determine B2 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Screamer mice exhibit decreased percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Screamer mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Screamer mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Screamer mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Screamer mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Screamer mice exhibit increased frequencies of peripheral B1b cells. Flow cytometric analysis of peripheral blood was utilized to determine B1b cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Screamer mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Screamer mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Screamer mice exhibit reduced expression of B220 on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B220 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Screamer mice exhibit reduced expression of IgD on peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Screamer mice exhibit increased expression of CD44 on peripheral CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The screamer phenotype was discovered while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0511 for T-dependent and T-independent humoral responses.  The screamer mice lack T-dependent IgG responses to both aluminum hydroxide (alum)-emulsified ovalbumin (OVA) (Figure 1) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (Figure 2) as well as a T-independent IgM response to NP-Ficoll (Figure 3).

 

Flow cytometric analysis of peripheral blood determined that the screamer mice exhibit a strong deficiency in B cells (Figure 4), B2 B cells (Figure 5), IgD+ B cells (Figure 6), IgM+ B cells (Figure 7), T cells (Figure 8), CD4+ T cells (Figure 9), and CD8+ T cells (Figure 10). Flow cytometric analysis of peripheral blood determined that the screamer mice showed an increased frequency in B1b cells (Figure 11), macrophages (Figure 12), and neutrophils (Figure 13). Some mice showed reduced expression of B220 on B cells (Figure 14), reduced IgD expression on B cells (Figure 15), and increased expression of CD44 on CD4 T cells (Figure 16).

Nature of Mutation

Figure 17. Linkage mapping of the increased frequency of B1b cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 119 mutations (X-axis) identified in the G1 male of pedigree R0511. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 119 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Prkdc:  a G to T transversion at base pair 15,831,282 (v38) on chromosome 16, equivalent to base pair 193,417 in the GenBank genomic region NC_000082 encoding Prkdc.  The strongest association was found with a recessive model of linkage to the normalized frequency of B1b cells, wherein four variant homozygotes departed phenotypically from 23 homozygous reference mice and 24 heterozygous mice with a P value of 4.964 x 10-47 (Figure 17).  A semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed. 

 

The mutation corresponds to residue 11,142 in the NM_011159 mRNA sequence in exon 78 of 86 total exons.

 

11127 CCTGGACAATATGATGGAAAAAGCAAACCACTG

3702  -P--G--Q--Y--D--G--K--S--K--P--L-

 

The mutated nucleotide is indicated in red lettering and results in a glycine (G) to premature stop codon (*) substitution at amino acid 3707 in the DNA-PKCS protein. The effect of the mutation in the Prkdc mRNA and the encoded protein has not been determined.

Protein Prediction
Figure 18. Domain structure of DNA-PKCS.  The DNA-PKCS protein has three tetratricopeptide repeats (TPR) that are involved in protein-protein interactions such as with the Ku70/Ku80 heterodimer to form the DNA-PK complex.  The catalytic site is within the PIKK domain at the C-terminus.  FAT domains flank the PI3K/PI4K (PIKK) domain.  The N-terminus has three HEAT repeats. The screamer mutation is indcated. This image is interactive; click to view other mutations in Prkdc.

The screamer mutation (G3707*) may truncate the DNA-PKCS protein between the FAT domain (named for its homology to FRAP, ATM and TRRAP, aa 2884-3539) and the catalytic PIKK (phosphatidylinositol 3-kinase-like kinases domain; aa 3747-4105), likely impairing the function DNA-PKCS (Figure 18). FAT and FATC domains occur in combination in PIKK family members, and are proposed to maintain a structural conformation that is necessary for the catalytic site (7;8). The FATC domain is essential for the kinase activity of DNA-PKCS (9-11).

 

Please see the record clover for information about Prkdc.

Putative Mechanism

DNA-PKCS is the catalytic subunit of the DNA-PK complex and is essential for DNA double-strand break repair during nonhomologous end joining (NHEJ) and during the assembly of immune receptor genes (i.e., V(D)J recombination) in developing lymphocytes. Mutations in the kinase domain of Prkdc lead to an inability to participate in NHEJ and V(D)J recombination (12). Mutations in Prkdc are linked to severe combined immunodeficiency (SCID) in several animal models, a condition marked by lymphopenia, hypogammaglobulinemia, and impaired T and B cell-mediated functions (e.g. defective V(D)J recombination and reduced numbers of peripheral lymphocytes) (13-15). Mutations in Prkdc also exhibit uncapped telomeres and a large number of telomeric fusions, leading to genomic instability (13;16;17). In a spontaneous mouse model of SCID, a DNA-PKCS point mutation resulting in the loss of 83 C-terminal amino acids, a reduction in protein expression, and a block in lymphocyte development has been identified (1)

Primers PCR Primer
screamer(F):5'- AGCAGTGTACAGAGATGCACTCTCA -3'
screamer(R):5'- TTCAGGGCTGACCATCTGGTACTT -3'

Sequencing Primer
screamer_seq(F):5'- ccacaaaaactcacctgcc -3'
screamer_seq(R):5'- atccgcctgcctctgtc -3'
Genotyping
Screamer genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

PCR Primers

Screamer(F): 5' - AGCAGTGTACAGAGATGCACTCTCA -3'

Screamer(R): 5' -TTCAGGGGCTGACCATCTGGTACTT -3'

 

Sequencing Primers

Screamer_seq(F): 5' - CCACAAAAACTCACCTGCC -3'

Screamer_seq(F): 5' -​ATCCGCCTGCCTCTGTC -3'

 

PCR program

1) 94°C      2:00

2) 94°C      0:30

3) 55°C      0:30

4) 72°C      1:00

5) repeat steps (2-4) 40X

6) 72°C      10:00

7) 4°C        hold

 

The following sequence of 744 nucleotides (from GenBank genomic region NC_000082 for linear DNA sequence of Prkdc​) is amplified:


193484                                                agcagtg tacagagatg
193501 cactctcatc tttattgaca gctgtgcaat tacatttaac agggaagaaa agctgtttcc
193561 tttttcttgt ttttcttttt taaacaggat ctcaccattt agaccaggct ggcctggaac
193621 ccacaaaaac tcacctgcct ctgtctcctg ggtgctgggg ttaaaggtga agcctcacct
193681 ggttgtggct aatttctata aatgacaact ttgaattaaa aatataagaa tgttacataa
193741 actttctata ttagatcaac atacatgttt ttaaatatgt aggttttata acagacagtt
193801 cctaagcaag gctctgtgtt tgctctagga caatatgatg gaaaaagcaa accactgcct
193861 gaatatcacg tgcggatctc tggatttgat gagcgggtaa gttgtatttg tcattgttgt
193921 ttctgtgaca tttgatgtat tggtcaacat tccactagca ttttgttccc gaattatagt
193981 attgatcaaa ttcctaaaga tagtgtctcc aatgtttcag tatcagttat attttagaat
194041 attgtagccg ggcatggtgg cgcatgcctt taatctcagc acttgggaga cagaggcagg
194101 cggatttctg agttcaaggc cagcctggtc tacagagtga gttccaggat agccagggct
194161 atacagagaa accctgtctt gggaaaaaaa acaaggatat tataagtacc agatggtcag
194221 ccctgaa

 

Primer binding sites are underlined and the sequencing primer sites are highlighted; the mutated nucleotide is shown in red text. 

References
Science Writers Anne Murray
Illustrators Victoria Webster, Peter Jurek, Katherine Timer
AuthorsKuan-Wen Wang, Ming Zeng, Jin Huk Choi, Bruce Beutler