Phenotypic Mutation 'Tremord'

• Allele: Tremord
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 100,911,385 bp (GRCm39)
• Base Change: G ⇒ T (forward strand)
• Gene: Scn8a
• Gene Name: sodium channel, voltage-gated, type VIII, alpha
• Synonym(s): nmf335, nmf58, NMF335, C630029C19Rik, nur14, mnd2, seal, mnd-2, nmf2, med, ataxia 3, NaCh6, Nav1.6, motor end-plate disease
• Chromosomal Location: 100,767,739-100,943,819 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010] ; PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tryptophan changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000080842; Gene: ENSMUSG00000023033; AA Change: W935L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000082209)
• SMART Domains: Protein: ENSMUSP00000104536; Gene: ENSMUSG00000023033; AA Change: W935L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	1.9e-76	PFAM
low complexity region	367	378	N/A	INTRINSIC
Pfam:Ion_trans	451	640	1.1e-47	PFAM
Pfam:Na_trans_assoc	655	872	1.9e-71	PFAM
Pfam:Ion_trans	898	1127	4.4e-59	PFAM
PDB:1BYY|A	1129	1181	7e-30	PDB
Pfam:Ion_trans	1220	1429	1.9e-51	PFAM
Pfam:PKD_channel	1281	1436	5.6e-7	PFAM
IQ	1558	1580	1.2e-4	SMART
low complexity region	1619	1638	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000108908)
• SMART Domains: Protein: ENSMUSP00000104537; Gene: ENSMUSG00000023033; AA Change: W945L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	72	322	2.2e-76	PFAM
low complexity region	335	364	N/A	INTRINSIC
Pfam:DUF3451	390	616	8.7e-70	PFAM
Pfam:Ion_trans	697	886	1.3e-47	PFAM
Pfam:Na_trans_assoc	901	1118	2.3e-71	PFAM
Pfam:Ion_trans	1144	1186	9.7e-10	PFAM
Pfam:Ion_trans	1182	1332	1.7e-31	PFAM
PDB:1BYY|A	1334	1386	2e-29	PDB
Pfam:Ion_trans	1425	1634	2.3e-51	PFAM
Pfam:PKD_channel	1486	1641	6.6e-7	PFAM
IQ	1763	1785	1.2e-4	SMART
low complexity region	1824	1843	N/A	INTRINSIC

• SMART Domains: Protein: ENSMUSP00000104538; Gene: ENSMUSG00000023033; AA Change: W935L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	160	410	2.5e-76	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:DUF3451	478	704	9.6e-70	PFAM
Pfam:Ion_trans	785	974	1.4e-47	PFAM
Pfam:Na_trans_assoc	989	1206	2.5e-71	PFAM
Pfam:Ion_trans	1232	1461	5.7e-59	PFAM
PDB:1BYY|A	1463	1515	4e-29	PDB
Pfam:Ion_trans	1554	1763	2.5e-51	PFAM
Pfam:PKD_channel	1615	1770	7.1e-7	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000108910)
• SMART Domains: Protein: ENSMUSP00000144371; Gene: ENSMUSG00000023033; AA Change: W935L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	4.1e-80	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	2.5e-69	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	1.2e-55	PFAM
Pfam:Na_trans_assoc	989	1191	9.1e-57	PFAM
Pfam:Ion_trans	1195	1274	7.6e-16	PFAM
Pfam:Ion_trans	1270	1431	2.6e-33	PFAM
Pfam:Ion_trans	1478	1734	6.5e-55	PFAM
IQ	1851	1873	6e-7	SMART
low complexity region	1912	1931	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000200963)
• SMART Domains: Protein: ENSMUSP00000143879; Gene: ENSMUSG00000023033

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	8.8e-81	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	6.7e-70	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	804	5.3e-9	PFAM

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000144013; Gene: ENSMUSG00000023033; AA Change: W935L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	131	422	7.4e-82	PFAM
low complexity region	423	452	N/A	INTRINSIC
Pfam:Na_trans_cytopl	499	700	3.5e-72	PFAM
low complexity region	701	712	N/A	INTRINSIC
Pfam:Ion_trans	750	985	2.2e-57	PFAM
Pfam:Na_trans_assoc	989	1191	2e-59	PFAM
Pfam:Ion_trans	1195	1472	6.2e-69	PFAM
Pfam:Ion_trans	1519	1775	1.2e-56	PFAM
IQ	1892	1914	1.2e-4	SMART
low complexity region	1953	1972	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000201549)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably essential (E-score: 0.800)
• Phenotypic Category: Autosomal Semidominant
• Penetrance: 100%
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Embryos
• MMRRC Submission: 030742-UCD
• Last Updated: 2018-05-22 9:44 AM by Anne Murray
• Record Created: unknown
• Record Posted: 2008-10-07
• Science Writers: Nora G. Smart, Anne Murray
• Illustrators: Diantha La Vine
• Authors: Holly Timms, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001077499; MGI: 103169

Alleles Listed at MGI

All alleles(27) : Targeted(2) Gene trapped(11) Transgenic(1) Spontaneous(5) Chemically induced(8)

Phenotypic Description

TremorD was identified as a visible mutant amongst N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice, and is a recessive or weakly semidominant phenotype characterized by a tremor and a gait disturbance, both of varying severity.

Nature of Mutation

The TremorD mutation was mapped to Chromosome 15, and corresponds to a G to T transversion at position 2919 of the Scn8a transcript, in exon 16 of 27 total exons.

 

2903 GTGCTGTGTGGGGAGTGGATCGAGACCATGTGG

930  -V--L--C--G--E--W--I--E--T--M--W-

 

The mutated nucleotide is indicated in red lettering, and causes a tryptophan to leucine substitution at residue 935 of the SCN8A sodium channel.

Protein Prediction

The voltage-gated sodium channels form part of the ion channel superfamily that also includes voltage-gated potassium and calcium channels.  The 1978 amino acid protein SCN8A (also known as Na_v1.6) is a voltage-gated sodium channel α subunit.  The α subunit, approximately 220-260 kDa in size, is the pore-forming entity of sodium channels, and may be joined by one or more auxiliary β subunits that modify the kinetics and voltage dependence of channel gating, and regulate channel localization and interaction with cell adhesion molecules, extracellular matrix and cytoskeletal components (1-3).  Nine proteins comprise the mammalian sodium channel family, and all are greater than 50% identical in the transmembrane and extracellular domains, although the intracellular domains are not highly conserved and they display distinct, voltage-dependence as well as unique kinetic and pharmacological properties [reviewed in (4)].  The nomenclature of the channel is determined by the principal permeating ion (Na), the principal physiological regulator (voltage, indicated as the abbreviated subscript, v), the gene subfamily number (currently only 1), and a specific channel number (1-9, assigned based on the order in which they were identified).  Splice variants are identified by lowercase letters following the channel number (see record for Possum).

 

 

Figure 1. A, Domain structure of SCN8A. B, Transmembrane organization of sodium channel subunits. Cylinders represent probable α-helical transmembrane segments (numbered 1-6 for each domain) with green cylinders indicating the pore-lining segments and yellow cylinders indicating the S4 voltage sensors (positively charged residues are represented by the + signs). The extracellular immunoglobulin-like domains of the β1 and β2 subunits are shown and a site of interaction between the  α and β1 subunit is indicated by the wavy, gray lines. Consensus phosphorylation sites are indicated by the orange circles. Purple circles represent the outer (EEDD) and inner (DEKA) rings of amino acid residues forming the ion selectivity filter and the TTX binding site. White circles indicate residues critical for fast inactivation. Binding sites for α- and β-scorpion toxins and anesthetic drugs are also shown. The residue affected by the TremorD mutation is located in the pore loop between the S5 and S6 helices in domain II, and is adjacent to the glutamic acid (E) that forms part of the inner ring of the ion selectivity filter. Image is interactive; click to see another Scn8a​ mutation.

Na_v1.6, like the other sodium channel α subunits, contains four homologous domains (I-IV) each consisting of six transmembrane α helices (S1-S6) (see Figure 1) (5;6).  A membrane-reentrant extracellular loop called the “pore loop” is located between the S5 and S6 helices in each of the four domains [see (4;7) and references therein for detailed information on sodium channel structure].  The pore loops line the outer, narrow entry to the pore, and each loop contributes one amino acid to both the outer and inner rings serving as the ion selectivity filter in the outer pore of the channel.  The outer ring of acidic residues is EEDD, while the inner ring is DEKA.  A single amino acid residue in the pore loop of domain I determines the affinity of different sodium channels for the pore blocker tetrodotoxin (TTX).   For example, rat cardiac sodium channels bind TTX with 200-fold lower affinity than brain or skeletal sodium channels because of the substitution of an aromatic tyrosine or phenylalanine residue with cysteine (8;9).  Na_v1.6 is highly sensitive to TTX (10).  The S4 helices constitute the voltage sensors of the channel, and contain positively charged amino acid residues (arginine and/or lysine) at every third position.  Depolarization of the membrane allows the S4 segments to move outward and initiate a conformational change that opens the pore.  This gating movement is targeted by the β-scorpion toxins, which enhance sodium channel activation by shifting voltage dependence to more negative membrane potentials (11).  The short, intracellular loop between domain III, S6 and domain IV, S1 functions as the inactivation gate, which folds into the channel and blocks the pore from the inside during sustained depolarization of the membrane.  A hydrophobic triad of isoleucine, phenylalanine and methionine (IFM) within this loop is critical for fast inactivation (see Background), and glycine and proline residues flanking the IFM motif serve as hinges to allow closure of the inactivation gate.  The S5 and S6 helices line the inner, wider exit from the pore, and local anesthetics (e.g. procaine, etidocaine, lidocaine) and related antiepileptic (e.g. phenytoin) and antiarrhythmic drugs (e.g. lidocaine, quinidine) all bind from inside the cell to overlapping sites within this pore to block ionic current through the channel.  Amino acids in the S6 segments from at least three of the four domains contribute to drug binding, with residues from the S6 helix of domain IV (F1752 and Y1759) being the most important (12;13). 

The most abundant mouse Na_v1.6 isoform is 1978 amino acids long (10).  Human SCN8A encodes a 1980-amino acid protein that shares close to 99% sequence identity with the mouse protein.  It contains several consensus sites for phosphorylation of serine and threonine residues that are also conserved in other sodium channel family members.  Na_v1.6 also contains a consensus site for tyrosine phosphorylation at residue 1151 (14).  The C-terminus of Na_v1.6 has been shown to bind to calmodulin (CaM), an interaction that is important for its functional activity and inactivation kinetics (15).  Two pairs of alternatively spliced exons have been identified in Scn8A/SCN8A consistent with related sodium channels, exons 5N and 5A and exons 18N and 18A (14;16).  Exons 5N and 5A encode part of transmembrane segment S3 and all of S4 in domain I and differ by a single amino acid at residue 212 (Asp in 5A and Asn in 5N) (14).  Exons 18A and 18N encode part of transmembrane segment S3 and all of S4 in domain III, but exon 18N has a conserved in-frame stop codon that predicts the synthesis of a truncated, two-domain protein. A cDNA transcript that deletes exon 18 but maintains an open reading frame has also been discovered (16).  Also observed are alternatively spliced forms of the linker region between SI and SII in domain I.  The major form of the transcript lacks 10 amino acids (11 in humans) following residue 664 in the I-II linker (10;14). 

The TremorD mutation is located in the pore loop between the S5 and S6 helices in domain II, and is adjacent to the glutamic acid (E) that forms part of the inner ring of the ion selectivity filter.

Expression/Localization

Seven of the ten channel isoforms (i.e. Nav1.1, Nav1.2, Nav1.3, Nav1.6, Nav1.7, Nav1.8 and Nav1.9) are expressed during some phase of development in neurons (2;3;17;18); three of the channels (Nav1.7, Nav1.8 and Nav1.9) are expressed primarily in the PNS (2).  Na_v1.6 is one of the most abundant voltage-gated sodium channels (VGSC) in the brain (6).  RT-PCR, in situ hybridization studies and immunohistochemistry in rats, mice and humans have found Na_v1.6 expression in the dendrites of output neurons of the cerebellum, cerebral cortex and hippocampus, and also in cerebellar Purkinje cells and granule cells, motor neurons of the brain stem, astrocytes, Schwann cells, and dorsal root ganglion (DRG) (6;19-22).  Na_v1.6 was identified as the major sodium channel present at the nodes of Ranvier (gaps in the myelin sheath) in mature myelinated sensory, motor and central nervous system (CNS) axons (23).  Na_v1.6 is also expressed in nonmyelinated axons (21).  Subcellular localization in the CNS includes dendrites, presynaptic and postsynaptic membranes (2;20;23;24).  In situ hybridization has also localized Scn8a mRNA expression to the ganglion and inner nuclear layers of the adult retina (25).

Na_v1.6 is not expressed in embryonic brain or spinal cord, but begins to be expressed shortly after birth (20).  The cDNA transcript expressing the alternatively spliced forms of exons 5 and 18 (5N and 18N) predominate in fetal and neonatal brain, whereas in adult brain the predominant transcript contains exons 5A and 18A.  Exon 18N is also expressed in non-neuronal tissues (16).      

Although Na_v1.6 is considered to be a neuronal sodium channel, expression has also been found elsewhere including the heart and certain immune cells.  In the heart, Na_v1.6 is restricted to the Z lines, regularly spaced lines that divide the myofibrils into sarcomeres (26).  Cultured microglia were shown to express the tetrodotoxin (TTX)-sensitive Nav1.1 and Nav1.6 channels as well as the TTX-resistant Nav1.5  channel; Nav1.2, Nav1.3 , Nav1.7, Nav1.8, and Nav1.9 were not detectable (2).  Nav1.6 is highly expressed in PNS and CNS neurons and is the predominant isoform in the cultured microglia (2).  Na_v1.6 is also expressed in microglia and macrophages in the CNS (27).  In primary human macrophages, Na_v1.6 expression occurs in a filamentous pattern that is independent of the activation state of the cell and is associated with cytoskeletal structures (28).

The Scn8a gene undergoes tissue-specific splicing by the neuronal splice factors Fox-1 and Fox-2 (24;29).  Transcripts that contain the alternative exon, 18A, encode the full-length channel and are restricted to the brain and nervous system (24).  Alternatively, transcripts that encode the other alternative exon, 18N, have an in-frame stop codon in exon 18N that encodes a truncated, inactive 2-domain protein (29).  Studies have determined that the full-length Nav1.6 protein is expressed in mouse ventricles, localized mainly in the t tubules of the myocyte (29).

Background

Figure 2. α-subunit of voltage-gated sodium channels. A, Structure of the Na v channel. Domains are numbered I through IV. The four domains form an ion selective pore in the membrane. The inactivation gate is between domains III and IV. In a resting state, the interior of the cell is negatively charged, while the exterior is positively charged. B, Deactivated, activated, and inactivated states of channel in cross-section. Positively charged residues in the voltage sensor S4 helices are indicated by the + signs. See text for details.

VGSCs are essential for the initiation and propagation of action potentials in neurons and excitable cells by mediating the rapid influx of sodium [reviewed in (7)] (Figure 2).  Three key features characterize sodium channels: voltage-dependent activation, rapid inactivation, and selective ion conductance (30).  VGSCs typically open (“activate”) within a millisecond in response to membrane depolarization, often leading to a regenerative all or none depolarization typical of action potentials in neurons.  Once activated, VGSCs do not remain open for long, and current through VGSCs can be terminated within approximately one millisecond by a process known as “fast inactivation” mediated by the intracellular inactivation gate folding into the channel and blocking the pore (see Protein Prediction).  Recovery from inactivation occurs after the cell membrane potential is repolarized to negative membrane potentials (mediated by other ion channels), allowing sodium channels to return to the resting or closed state in which they are again ready to open in response to membrane depolarization.

Microglia are immune cells in the brain and spinal cord and are activated following an injury, a pathogenic challenge, or from signaling within the central nervous system parenchyma (2).  Microglia express several cell surface and nuclear receptors as well as ion channels that respond to bacterial products, steroids, immunoglobins, cytokines and chemokines (2). The activation of microglia results in proliferation, migration, promotion of tissue repair and phagocytosis as well as the secretion of cytokines/chemokines, reactive species and proteases (2). The chloride, potassium, hydrogen and calcium channels expressed by microglia maintain membrane potential and intracellular ion concentrations (2).  In addition to the above-mentioned ion channels, microglia also express voltage-gated sodium channels (2;27).  Sodium channels in neurons function to generate and transmit action potentials.  In contrast, their function in non-excitable cells (e.g. lymphocytes (31), astrocytes (32), metastatic cancer cells (33), osteoblasts (34), odontoblasts (35), vein endothelial cells (36), chondrocytes (37), and keratinocytes(38)) is not fully known.  Sodium channels are present in and regulate the activity of microglia and macrophages in the CNS (27).  Both of these immune cells are activated during MS and contribute to axonal degeneration [reviewed in (39)]. Na_v1.6 expression is upregulated in microglia and macrophages in experimental models of MS and in acute lesions of MS patients (27).  Na⁺ channel blockade attenuates the inflammatory activity of these cells and reduces phagocytic activity in vitro.  Moreover, microglia from animals with mutations in Scn8a showed a significant reduction in phagocytic capacity compared to wild-type microglia.  These data suggest that Na_v1.6 plays an important role in microglia activation and that Na_v1.6 activity may contribute to axonal damage in MS both directly and indirectly.  Despite these data, bacterial phagocytosis by macrophages depends on Na_v1.5 not Na_v1.6, although colocalization of Na_v1.6 with F-actin and vimentin suggests possible regulation of cytoskeleton, which is also important for macrophage function (23).  Mice with mutations in Scn8a have been reported to have abnormal ratios of T cell subsets along with reduced suppressor cell function and precocious maturation of the cytotoxic response to allogeneic cells, but it is unknown whether these defects are secondary to the neurological abnormalities present in these animals (40;41).

Following injury or infection to the CNS, activated microglia have a prominent role in phagocytosis.  To test whether Nav1.6 channels are involved in LPS-stimulated phagocytosis, the microglia from med mice (lack functional Nav1.6 channels (42)) were tested for their ability to phagocytose latex beads after LPS activation (2;27).  Following LPS stimulation, phagocytosis was reduced by 65% in microglia in the med mice (compared to wild-type cohorts) (2).  In contrast, previous reports with human macrophages and human monocytic-derived THP-1 cells  were dissimilar to the rodent studies indicating that there may be a cell and/or species specific role for sodium channels in phagocytosis (2).

LPS stimulation results in a stark increase in the secretion of cytokines from activated microglia.  Microglial cultures treated with sodium channel blockers phenytoin and TTX were assayed for changes in the secretion of cytokines after LPS stimulation.  Treatment of the cultures with phenytoin led to a 50-60% decrease in the secretion of cytokines (i.e. IL-1α, IL-1β, and TNF-α) from the LPS-stimulated microglia (2).  The levels of IL-6 and IL-10 were not significantly changed upon phenytoin treatment.  TTX treatment (provides blockade of Nav1.1 and Nav1.6, but only partial blockade of Nav1.5) led to a decrease in IL-1α, IL-1β, and TNF-α as well (2).  Taken together, these results indicate that the activity of sodium channels in microglia is essential for the release of some, but not all, cytokines after LPS stimulation.

Microglia were also examined to determine if Nav1.6 were necessary for microglial migration.   A trans-well migration assay comparing microglia cultured from wild-type and med mice found that the med microglia, unlike the wild-type, did not have an increase in the migration of activated cells (2).  These results indicate that in addition to the other roles for sodium channels in microglia function, as discussed above, the Nav1.6 channels also function in the migration of activated microglia (2).  The role of Nav1.6 in cell invasion has also been demonstrated in other cell types.  For example, the upregulation of the channel led to potentiation of metastasis of several cancer cell lines including prostate, breast, lymphoma, and cervical (2;43-45). As in other eukaryotic cells, the levels of free calcium are tightly regulated are essential for signaling in microglia (2).  The Nav1.6 channel also produces a persistent sodium current that can reverse the operation of the sodium-calcium exchanger (NCX), leading to importation of calcium into the cytoplasm (2).  It is proposed that Nav1.6 activity contributes to microglial migration by regulating the activity of the NCX (2).

In the heart, the sodium channels, including Nav1.6 and Nav1.1 are proposed to be involved in (a) excitation-contraction coupling by synchronizing the action potential in the sarcolemma of the t tubules and/or (b) the automaticity of sinoatrial nodal cells of the mouse heart (29).   After heart failure, there is a down-regulation of Nav1.1 and Nav1.6 (29).

In neurons (e.g. cerebellar Purkinje cells, dorsal root ganglia C-fibers, spinal sensory neurons, trigeminal neurons, subthalamic neurons, retinal ganglion cells, pre-frontal cortical pyramidal neurons, hippocampal CA1 neurons, globus pallidus neurons, and cerebellar granule cells), mutations of Nav1.6 lead to reductions in repetitive firing and persistent currents (21;24;46).

Studies have implicated a change in Nav1.6 expression in the dorsal root ganglia as a factor in type 2-associated diabetic neuropathic pain (47).  It is abnormal, spontaneous activity in the DRG neurons that is considered the instigator of neuropathic pain (47).  Type 2 diabetes causes a significant increase in the expression of both the Nav1.6 protein and mRNA in the DRG (47).  The role of Nav1.3 and Nav1.8 in the development of neuropathic pain has been studied, through the findings are controversial (47).

Several mouse strains containing mutations in the Scn8a gene have been identified and provide insights into the role Na_v1.6 plays in neuronal function [reviewed in (48)].  Functionally null mutations include two alleles (Scn8a^med and Scn8a^tg) that respectively result in early protein truncation and a large internal deletion as well as targeted Scn8a mutations (5;42;49).  Homozygotes for these null mutations are characterized by tremor, ataxia, early-onset progressive paralysis of the hind limbs, severe muscle atrophy, degeneration of Purkinje cells, and juvenile lethality (29).  The age of lethality at three weeks corresponds to the final stage of developmental replacement of sodium channel Na_v1.2 at immature nodes of Ranvier by Na_v1.6 (50).  Less severe mutations of Scn8a (Scn8a^med-J and jolting or Scn8a^med-jo) cause ataxia, tremor, muscle weakness, and dystonia.  The Scn8a^med-J mutation is a 4bp deletion in the splice donor site of intron 3 that results in skipping of exons 2 and 3 and resulting in protein truncation in domain 1 (42).  However 12% of the transcripts are correctly spliced leading to a hypomorphic phenotype.  Homozygotes have severe muscle weakness and dystonia.  In C57BL/6J mice, this allele causes juvenile lethality because these animals are also homozygous for a mutation in the sodium channel modifier 1 (SCNM1), a zinc finger protein and a putative splice factor that causes reduction of correctly spliced Scn8a transcripts (51;52).  The Scn8a^med-jo mutation occurs in the linker region between transmembrane helices S4 and S5 in domain III of Na_v1.6 (53).  Homozygous animals carrying this mutation have chronic ataxia with an altered gait, tremor of the head and neck induced by attempted movement, as well as progressive loss of Purkinje cells that are known to be important for motor coordination (54).  To test the importance of cerebellar Na_v1.6 function on motor coordination, Scn8a was specifically deleted in Purkinje and granule neurons.  Deletion of Scn8a in Purkinje cells resulted in mice that exhibited mild ataxia, tremor, and impaired coordination, while deletion in granule cells resulted in only mild behavioral deficits (55).  Phenotypes were exacerbated in double mutants lacking Scn8a in both Purkinje and granule cells.

Electrophysiological studies of these mutants (see Putative Mechanism) and of Na_v1.6 in in vitro systems suggest that Na_v1.6 is required for persistent (non-inactivating) sodium current in several classes of neurons, including some with pacemaker roles (2;10;56).  In Purkinje cells, SCN8A deficiency not only affects persistent current but also reduces bursting activity and resurgent current, an unusual current that is found in some neurons and occurs when the cells are repolarized to intermediate potentials following a strong depolarization that completely inactivates transient sodium current (46).

In humans, only one SCN8A mutation has been found to be linked with disease. In a patient with mental retardation, pancerebellar atrophy, and ataxia, a 2-bp deletion in exon 24 of SCN8A was discovered (57).  Three additional family members, who were heterozygous for this mutation, exhibited milder cognitive behavioral deficits including attention deficit hyperactivity disorder (ADHD; OMIM #143465).  In addition, preferential transmission of one allele of a single-nucleotide polymorphism in intron 21 was found in families with histories of attempted suicide (58).  These data suggest that Na_v1.6 may have an important role in human behavior, and is supported by behavioral studies of mice heterozygous for a null mutation of Scn8a.  These mice exhibit greater conditioned freezing in the Pavlovian fear conditioning paradigm, more pronounced avoidance of well-lit, open environments, and more stress-induced coping behavior, but showed normal learning and memory (59).  Although mutations of SCN8A have not been associated with epilepsy, Na_v1.6 may play a modifying role in this condition (60).  Mutations in the sodium channels SCN1A and SCN2A, encoding Na_v1.1 and Na_v1.2, are known to cause several types of epilepsy in humans (OMIM #604233, #607745, #607208), and animals heterozygous for a targeted disruption of Scn1a exhibit spontaneous seizures (61).  By contrast, mice heterozygous for Scn8a mutations are more resistant to chemically induced seizures and have ameliorated seizure severity in a Scn1a heterozygous background (60).

Increasing evidence suggests that Na_v1.6 also plays a role in the disease process of multiple sclerosis (MS; OMIM #126200) [reviewed in (39)].  In MS, myelinated axons are denuded of myelin and/or degenerate.  The higher density of sodium channels, primarily Na_v1.6, in the nodes of Ranvier in myelinated axons supports saltatory conduction, a process by which the action potential leaps discontinuously and rapidly from one node of Ranvier to the next.  Although the myelin lost in MS is not usually replaced in full, remissions can occur due to the redistribution of sodium channels, including Na_v1.6, along the axon, allowing the restoration of action potential conductance (62;63).  In addition to becoming demyelinated, some axons degenerate in MS.  Injury and inflammation leading to increased concentrations of nitric oxide (NO) in affected neurons has a deleterious effect on mitochondria and ATP production.  This causes a failure of the Na⁺/K⁺ ATPase, which pumps Na⁺ out of the cytoplasm.  Sustained Na⁺ influx drives reverse operation of the Na⁺-Ca²⁺ exchanger, allowing deleterious amounts of Ca²⁺ into the axon.  Ca²⁺ influx triggers a host of secondary cascades, such as activation of proteases and lipases, leading to axonal injury.  Axonal degeneration may be exacerbated by the increased distribution of Na_v1.6 along the axon because Na_v1.6 produces a large, persistent Na⁺ current that could trigger the Na⁺-Ca²⁺ exchanger (64).  Sodium channel blockers such as phenytoin have a protective effect in an experimental model of MS (39).  Mice with an induced form of an inflammatory/demyelinating form of multiple sclerosis (MS) (i.e. experimental autoimmune encephalomyelitis (EAE)) have a significant upregulation of Nav1.6 within activated microglia, corresponding to an upregulation of CD11b/c and CD45 in these cells (2;27).  In these mice, there is a correlation between the severity of the EAE and amount of Nav1.6 expressed as well as the morphology of the microglia to an amoeboid-like appearance (2).  In addition, there is an upregulation in Nav1.6 in microglia within MS lesions (27).  Treatment of mice inoculated with myelin oligodendrocyte glycoprotein to induce EAE with a sodium channel blocker (i.e. phenytoin) led to a decrease in the density of CD45/CD11b/c-positive microglia, indicating that sodium channels are involved in the activation of microglia during inflammation and demyelination (2).

Putative Mechanism

Allelic mutations of Scn8a in the mouse have revealed a range of neurological disorders that can be explained by the wide distribution and unique properties of the Na_v1.6 sodium channel.  In null mutations, the sciatic nerve between 17 and 23 days of age exhibits reduced conduction velocity, prolonged refractory period and widening of the non-myelinated gaps at the nodes of Ranvier (51).  These changes are accompanied by failure of transmission at the neuromuscular junction and muscle denervation (65;66).  The paralysis and death in mice with null Scn8a mutations is likely due to motor neuron dysfunction.  In mature motor neurons (as in the CNS), Na_v1.6 is the major channel present at the nodes of Ranvier and is required for normal saltatory conductance.  The total sodium current of these neurons increases three fold during the first week of life in normal mice, is dependent upon Na_v1.6 function, and corresponds to the increasing expression of Na_v1.6 in mature nodes of Ranvier (50;67).  Death in these animals may be due to the failure of the motor neurons innervating the diaphragm muscle. 

Unlike the null alleles, Scn8a^med-jo mice have normal neuromuscular junctions (66), and the primary abnormality is the inability of Purkinje cells to spontaneously generate a repetitive Na⁺-dependent action potential.  The Scn8a^med-jo mutation occurs in the S4-S5 linker region of domain III, which is predicted to play a role in inactivation.  However, in vitro analysis suggests that the mutation alters the voltage dependence of the channel, resulting in a depolarizing shift.  The mutant channel is more stable in the closed state than the wild-type channel and requires a stronger depolarization across the cell to elicit opening (53).  This defect results in reduction in Purkinje cell firing.  As the effects of Purkinje cell discharge are inhibitory, a decrease in the inhibitory signal from the cerebellum results in loss of control of rapid movements and poor correlation between posture and movement.  The results of targeted deletions of Na_v1.6 in Purkinje cells support this hypothesis as the loss of Na_v1.6 specifically from these cells results in decreased rates of Purkinje cell firing (55).  The differences in phenotypes between null Scn8a alleles and hypomorphic alleles suggest that in motor neurons Na_v1.6 functions primarily in the propagation of action potentials, whereas in the cerebellum it is also required for initiation of action potentials.  Thus, the motor neurons in jolting mice are less affected by the small change in voltage dependence of Na_v1.6, whereas the higher-voltage activation threshold of the mutant channel may reduce the chances of action potential initiation in Purkinje cells in response to low-amplitude inputs from the mossy fiber/granule cell system.

Alleles of Scn8a are considered recessive although mild phenotypes are occasionally reported in heterozygotes (40).  Haploinsufficiency of Scn8a is generally thought to be the mechanism behind the occasional phenotypes seen in heterozygotes.  These data are consistent with the phenotypes of TremorD mice, which are similar to the phenotypes seen in Scn8a^med-jo homozygotes.  As the Scn8a^med-jo mutation affects the voltage gating of the channel, TremorD may similarly shift the voltage dependence of the sodium channel.  Indeed, the TremorD mutation occurs in the pore loop, which is known to be essential both for ion selectivity and voltage gating (68).  The importance of this region in the function of Na_v1.6 is supported by the discovery of three ENU missense mutations occurring in the pore loop of domain 3.  Two of these mutations cause phenotypes similar to those seen in null alleles of Scn8a, while the third causes a less severe movement disorder and sustained dystonic postures (69).  The two mutations causing the more severe phenotypes are located in the extracellular region of the loop and contribute to the structure of the outer pore, while the non-lethal mutation is located within the membrane.  These data suggest that the pore loop residues present within the membrane portions have less effect on the function of the sodium channel, and support evidence that regions located immediately outside the membrane are essential for maintaining overall pore structure (70).  The residue altered by the TremorD is adjacent to the glutamic acid (E) that forms part of the inner ring of the ion selectivity filter (see Protein Prediction) (71).

Primers

Primers cannot be located by automatic search.

Genotyping

TremorD genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.  

 

Primers for PCR amplification

TremD(F): 5’- ACAGTCTGCGACACGATCAGGAAG -3’

TremD(R): 5’- CCTGCTCTCAGGAGCACAAGTTAC -3’

 

PCR program (use SIGMA JumpStart REDTaq)

1) 94°C             2:00

2) 94°C             0:30

3) 56°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

Primers for sequencing

TremD_seq(F): 5’- CAAGATCATTGGGAACTCCGTTG -3’

TremD_seq(R): 5’- GGAGCACAAGTTACCCACTG -3’

 

The following sequence of 673 nucleotides (from Genbank genomic region NC_000081 for linear DNA sequence of Scn8a) is amplified:

 

142405                           acagtc tgcgacacga tcaggaagtt ctgagaattt

142441 cctaaggatg gatgataaat aaatttaagc caatctttct aattctgcat ttttttttat

142501 ttcagcaatg tggggtagca gattatcatt tcatatttta ttatttgtct ccttagctcc

142561 gagtcttcaa attggccaag tcctggccca ccctgaacat gctgatcaag atcattggga

142621 actccgttgg cgccctgggc aacctgaccc tggtgctggc catcattgtc ttcatctttg

142681 ccgtggtggg gatgcagctc tttggaaaga gctacaagga gtgcgtctgt aagatcagcc

142741 aggagtgcaa gctcccgcgc tggcacatga acgacttctt ccactccttc ctcatcgtct

142801 tccgagtgct gtgtggggag tggatcgaga ccatgtggga ttgcatggaa gtggccggcc

142861 aggccatgtg ccttatcgtg ttcatgatgg tcatggtcat cggcaacctg gtggttagta

142921 ccaacgtctt cttctccacc accttctctg gtgaactctt tcctggccca gatctgtgtt

142981 aaggcccatc agctaccatc tcccaaatct caatgaccag aaatgtccgc agactttgcc

143041 acgtgttcag tgggtaactt gtgctcctga gagcagg

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated G is shown in red text.

References

  1. Isom, L. L. (2001) Sodium Channel Beta Subunits: Anything but Auxiliary. Neuroscientist. 7, 42-54.

  2. Black, J. A., and Waxman, S. G. (2011) Sodium Channels and Microglial Function. Exp. Neurol.. .

  3. Tan, J., and Soderlund, D. M. (2011) Independent and Joint Modulation of Rat Nav1.6 Voltage-Gated Sodium Channels by Coexpression with the Auxiliary beta1 and beta2 Subunits. Biochem. Biophys. Res. Commun.. 407, 788-792.

  4. Catterall, W. A., Goldin, A. L., and Waxman, S. G. (2005) International Union of Pharmacology. XLVII. Nomenclature and Structure-Function Relationships of Voltage-Gated Sodium Channels. Pharmacol. Rev.. 57, 397-409.

  5. Burgess, D. L., Kohrman, D. C., Galt, J., Plummer, N. W., Jones, J. M., Spear, B., and Meisler, M. H. (1995) Mutation of a New Sodium Channel Gene, Scn8a, in the Mouse Mutant 'Motor Endplate Disease'. Nat. Genet.. 10, 461-465.

  6. Schaller, K. L., Krzemien, D. M., Yarowsky, P. J., Krueger, B. K., and Caldwell, J. H. (1995) A Novel, Abundant Sodium Channel Expressed in Neurons and Glia. J. Neurosci.. 15, 3231-3242.

  7. Catterall, W. A. (2000) From Ionic Currents to Molecular Mechanisms: The Structure and Function of Voltage-Gated Sodium Channels. Neuron. 26, 13-25.

  8. Satin, J., Kyle, J. W., Chen, M., Bell, P., Cribbs, L. L., Fozzard, H. A., and Rogart, R. B. (1992) A Mutant of TTX-Resistant Cardiac Sodium Channels with TTX-Sensitive Properties. Science. 256, 1202-1205.

  9. Backx, P. H., Yue, D. T., Lawrence, J. H., Marban, E., and Tomaselli, G. F. (1992) Molecular Localization of an Ion-Binding Site within the Pore of Mammalian Sodium Channels. Science. 257, 248-251.

  10. Smith, M. R., Smith, R. D., Plummer, N. W., Meisler, M. H., and Goldin, A. L. (1998) Functional Analysis of the Mouse Scn8a Sodium Channel. J. Neurosci.. 18, 6093-6102.

  11. Cestele, S., Qu, Y., Rogers, J. C., Rochat, H., Scheuer, T., and Catterall, W. A. (1998) Voltage Sensor-Trapping: Enhanced Activation of Sodium Channels by Beta-Scorpion Toxin Bound to the S3-S4 Loop in Domain II. Neuron. 21, 919-931.

  12. Ragsdale, D. S., McPhee, J. C., Scheuer, T., and Catterall, W. A. (1996) Common Molecular Determinants of Local Anesthetic, Antiarrhythmic, and Anticonvulsant Block of Voltage-Gated Na+ Channels. Proc. Natl. Acad. Sci. U. S. A.. 93, 9270-9275.

  13. Ragsdale, D. S., McPhee, J. C., Scheuer, T., and Catterall, W. A. (1994) Molecular Determinants of State-Dependent Block of Na+ Channels by Local Anesthetics. Science. 265, 1724-1728.

  14. Plummer, N. W., Galt, J., Jones, J. M., Burgess, D. L., Sprunger, L. K., Kohrman, D. C., and Meisler, M. H. (1998) Exon Organization, Coding Sequence, Physical Mapping, and Polymorphic Intragenic Markers for the Human Neuronal Sodium Channel Gene SCN8A. Genomics. 54, 287-296.

  15. Herzog, R. I., Liu, C., Waxman, S. G., and Cummins, T. R. (2003) Calmodulin Binds to the C Terminus of Sodium Channels Nav1.4 and Nav1.6 and Differentially Modulates their Functional Properties. J. Neurosci.. 23, 8261-8270.

  16. Plummer, N. W., McBurney, M. W., and Meisler, M. H. (1997) Alternative Splicing of the Sodium Channel SCN8A Predicts a Truncated Two-Domain Protein in Fetal Brain and Non-Neuronal Cells. J. Biol. Chem.. 272, 24008-24015.

  17. Amaya, F., Decosterd, I., Samad, T. A., Plumpton, C., Tate, S., Mannion, R. J., Costigan, M., and Woolf, C. J. (2000) Diversity of Expression of the Sensory Neuron-Specific TTX-Resistant Voltage-Gated Sodium Ion Channels SNS and SNS2. Mol. Cell. Neurosci.. 15, 331-342.

  18. Felts, P. A., Yokoyama, S., Dib-Hajj, S., Black, J. A., and Waxman, S. G. (1997) Sodium Channel Alpha-Subunit mRNAs I, II, III, NaG, Na6 and hNE (PN1): Different Expression Patterns in Developing Rat Nervous System. Brain Res. Mol. Brain Res.. 45, 71-82.

  19. Whitaker, W., Faull, R., Waldvogel, H., Plumpton, C., Burbidge, S., Emson, P., and Clare, J. (1999) Localization of the Type VI Voltage-Gated Sodium Channel Protein in Human CNS. Neuroreport. 10, 3703-3709.

  20. Schaller, K. L., and Caldwell, J. H. (2000) Developmental and Regional Expression of Sodium Channel Isoform NaCh6 in the Rat Central Nervous System. J. Comp. Neurol.. 420, 84-97.

  21. Black, J. A., Renganathan, M., and Waxman, S. G. (2002) Sodium Channel Na(v)1.6 is Expressed Along Nonmyelinated Axons and it Contributes to Conduction. Brain Res. Mol. Brain Res.. 105, 19-28.

  22. Krzemien, D. M., Schaller, K. L., Levinson, S. R., and Caldwell, J. H. (2000) Immunolocalization of Sodium Channel Isoform NaCh6 in the Nervous System. J. Comp. Neurol.. 420, 70-83.

  23. Caldwell, J. H., Schaller, K. L., Lasher, R. S., Peles, E., and Levinson, S. R. (2000) Sodium Channel Na(v)1.6 is Localized at Nodes of Ranvier, Dendrites, and Synapses. Proc. Natl. Acad. Sci. U. S. A.. 97, 5616-5620.

  24. O'Brien, J. E., Drews, V. L., Jones, J. M., Dugas, J. C., Barres, B. A., and Meisler, M. H. (2011) Rbfox Proteins Regulate Alternative Splicing of Neuronal Sodium Channel SCN8A. Mol. Cell. Neurosci.. 49, 120-126.

  25. Cote, P. D., De Repentigny, Y., Coupland, S. G., Schwab, Y., Roux, M. J., Levinson, S. R., and Kothary, R. (2005) Physiological Maturation of Photoreceptors Depends on the Voltage-Gated Sodium Channel NaV1.6 (Scn8a). J. Neurosci.. 25, 5046-5050.

  26. Haufe, V., Camacho, J. A., Dumaine, R., Gunther, B., Bollensdorff, C., von Banchet, G. S., Benndorf, K., and Zimmer, T. (2005) Expression Pattern of Neuronal and Skeletal Muscle Voltage-Gated Na+ Channels in the Developing Mouse Heart. J. Physiol.. 564, 683-696.

  27. Craner, M. J., Damarjian, T. G., Liu, S., Hains, B. C., Lo, A. C., Black, J. A., Newcombe, J., Cuzner, M. L., and Waxman, S. G. (2005) Sodium Channels Contribute to microglia/macrophage Activation and Function in EAE and MS. Glia. 49, 220-229.

  28. Carrithers, M. D., Dib-Hajj, S., Carrithers, L. M., Tokmoulina, G., Pypaert, M., Jonas, E. A., and Waxman, S. G. (2007) Expression of the Voltage-Gated Sodium Channel NaV1.5 in the Macrophage Late Endosome Regulates Endosomal Acidification. J. Immunol.. 178, 7822-7832.

  29. Noujaim, S. F., Kaur, K., Milstein, M., Jones, J. M., Furspan, P., Jiang, D., Auerbach, D. S., Herron, T., Meisler, M. H., and Jalife, J. (2012) A Null Mutation of the Neuronal Sodium Channel NaV1.6 Disrupts Action Potential Propagation and Excitation-Contraction Coupling in the Mouse Heart. FASEB J.. 26, 63-72.

  30. HODGKIN, A. L., and HUXLEY, A. F. (1952) A Quantitative Description of Membrane Current and its Application to Conduction and Excitation in Nerve. J. Physiol.. 117, 500-544.

  31. DeCoursey, T. E., Chandy, K. G., Gupta, S., and Cahalan, M. D. (1985) Voltage-Dependent Ion Channels in T-Lymphocytes. J. Neuroimmunol.. 10, 71-95.

  32. Sontheimer, H., and Waxman, S. G. (1992) Ion Channels in Spinal Cord Astrocytes in Vitro. II. Biophysical and Pharmacological Analysis of Two Na+ Current Types. J. Neurophysiol.. 68, 1001-1011.

  33. Diss, J. K., Fraser, S. P., and Djamgoz, M. B. (2004) Voltage-Gated Na+ Channels: Multiplicity of Expression, Plasticity, Functional Implications and Pathophysiological Aspects. Eur. Biophys. J.. 33, 180-193.

  34. Black, J. A., Westenbroek, R. E., Catterall, W. A., and Waxman, S. G. (1995) Type II Brain Sodium Channel Expression in Non-Neuronal Cells: Embryonic Rat Osteoblasts. Brain Res. Mol. Brain Res.. 34, 89-98.

  35. Allard, B., Magloire, H., Couble, M. L., Maurin, J. C., and Bleicher, F. (2006) Voltage-Gated Sodium Channels Confer Excitability to Human Odontoblasts: Possible Role in Tooth Pain Transmission. J. Biol. Chem.. 281, 29002-29010.

  36. Gordienko, D. V., and Tsukahara, H. (1994) Tetrodotoxin-Blockable Depolarization-Activated Na+ Currents in a Cultured Endothelial Cell Line Derived from Rat Interlobar Arter and Human Umbilical Vein. Pflugers Arch.. 428, 91-93.

  37. Sugimoto, T., Yoshino, M., Nagao, M., Ishii, S., and Yabu, H. (1996) Voltage-Gated Ionic Channels in Cultured Rabbit Articular Chondrocytes. Comp. Biochem. Physiol. C. Pharmacol. Toxicol. Endocrinol.. 115, 223-232.

  38. Zhao, P., Barr, T. P., Hou, Q., Dib-Hajj, S. D., Black, J. A., Albrecht, P. J., Petersen, K., Eisenberg, E., Wymer, J. P., Rice, F. L., and Waxman, S. G. (2008) Voltage-Gated Sodium Channel Expression in Rat and Human Epidermal Keratinocytes: Evidence for a Role in Pain. Pain. 139, 90-105.

  39. Waxman, S. G. (2006) Axonal Conduction and Injury in Multiple Sclerosis: The Role of Sodium Channels. Nat. Rev. Neurosci.. 7, 932-941.

  40. Papiernik, M., Rieger, F., Ezine, S., and Pincon-Raymond, M. (1982) Impairment of T Lymphocyte Functions in Mice with Motor End-Plate Disease. Clin. Exp. Immunol.. 48, 429-436.

  41. Ezine, S., Papiernik, M., Rieger, F., and Pincon-Raymond, M. (1983) Modification of Helper and suppressor/cytotoxic Lymphocyte Subsets in Mice with Motor End-Plate Disease. Clin. Exp. Immunol.. 51, 475-478.

  42. Kohrman, D. C., Harris, J. B., and Meisler, M. H. (1996) Mutation Detection in the Med and medJ Alleles of the Sodium Channel Scn8a. Unusual Splicing due to a Minor Class AT-AC Intron. J. Biol. Chem.. 271, 17576-17581.

  43. Brackenbury, W. J., and Djamgoz, M. B. (2006) Activity-Dependent Regulation of Voltage-Gated Na+ Channel Expression in Mat-LyLu Rat Prostate Cancer Cell Line. J. Physiol.. 573, 343-356.

  44. Brackenbury, W. J., Djamgoz, M. B., and Isom, L. L. (2008) An Emerging Role for Voltage-Gated Na+ Channels in Cellular Migration: Regulation of Central Nervous System Development and Potentiation of Invasive Cancers. Neuroscientist. 14, 571-583.

  45. Fraser, S. P., Diss, J. K., Chioni, A. M., Mycielska, M. E., Pan, H., Yamaci, R. F., Pani, F., Siwy, Z., Krasowska, M., Grzywna, Z., Brackenbury, W. J., Theodorou, D., Koyuturk, M., Kaya, H., Battaloglu, E., De Bella, M. T., Slade, M. J., Tolhurst, R., Palmieri, C., Jiang, J., Latchman, D. S., Coombes, R. C., and Djamgoz, M. B. (2005) Voltage-Gated Sodium Channel Expression and Potentiation of Human Breast Cancer Metastasis. Clin. Cancer Res.. 11, 5381-5389.

  46. Raman, I. M., Sprunger, L. K., Meisler, M. H., and Bean, B. P. (1997) Altered Subthreshold Sodium Currents and Disrupted Firing Patterns in Purkinje Neurons of Scn8a Mutant Mice. Neuron. 19, 881-891.

  47. Ren, Y. S., Qian, N. S., Tang, Y., Liao, Y. H., Yang, Y. L., Dou, K. F., and Toi, M. (2011) Sodium Channel Nav1.6 is Up-Regulated in the Dorsal Root Ganglia in a Mouse Model of Type 2 Diabetes. Brain Res. Bull.. .

  48. Meisler, M. H., Plummer, N. W., Burgess, D. L., Buchner, D. A., and Sprunger, L. K. (2004) Allelic Mutations of the Sodium Channel SCN8A Reveal Multiple Cellular and Physiological Functions. Genetica. 122, 37-45.

  49. Levin, S. I., and Meisler, M. H. (2004) Floxed Allele for Conditional Inactivation of the Voltage-Gated Sodium Channel Scn8a (NaV1.6). Genesis. 39, 234-239.

  50. Boiko, T., Rasband, M. N., Levinson, S. R., Caldwell, J. H., Mandel, G., Trimmer, J. S., and Matthews, G. (2001) Compact Myelin Dictates the Differential Targeting of Two Sodium Channel Isoforms in the Same Axon. Neuron. 30, 91-104.

  51. Kearney, J. A., Buchner, D. A., De Haan, G., Adamska, M., Levin, S. I., Furay, A. R., Albin, R. L., Jones, J. M., Montal, M., Stevens, M. J., Sprunger, L. K., and Meisler, M. H. (2002) Molecular and Pathological Effects of a Modifier Gene on Deficiency of the Sodium Channel Scn8a (Na(v)1.6). Hum. Mol. Genet.. 11, 2765-2775.

  52. Buchner, D. A., Trudeau, M., and Meisler, M. H. (2003) SCNM1, a Putative RNA Splicing Factor that Modifies Disease Severity in Mice. Science. 301, 967-969.

  53. Kohrman, D. C., Smith, M. R., Goldin, A. L., Harris, J., and Meisler, M. H. (1996) A Missense Mutation in the Sodium Channel Scn8a is Responsible for Cerebellar Ataxia in the Mouse Mutant Jolting. J. Neurosci.. 16, 5993-5999.

  54. Dick, D. J., Boakes, R. J., and Harris, J. B. (1985) A Cerebellar Abnormality in the Mouse with Motor End-Plate Disease. Neuropathol. Appl. Neurobiol.. 11, 141-147.

  55. Levin, S. I., Khaliq, Z. M., Aman, T. K., Grieco, T. M., Kearney, J. A., Raman, I. M., and Meisler, M. H. (2006) Impaired Motor Function in Mice with Cell-Specific Knockout of Sodium Channel Scn8a (NaV1.6) in Cerebellar Purkinje Neurons and Granule Cells. J. Neurophysiol.. 96, 785-793.

  56. Maurice, N., Tkatch, T., Meisler, M., Sprunger, L. K., and Surmeier, D. J. (2001) D1/D5 Dopamine Receptor Activation Differentially Modulates Rapidly Inactivating and Persistent Sodium Currents in Prefrontal Cortex Pyramidal Neurons. J. Neurosci.. 21, 2268-2277.

  57. Trudeau, M. M., Dalton, J. C., Day, J. W., Ranum, L. P., and Meisler, M. H. (2006) Heterozygosity for a Protein Truncation Mutation of Sodium Channel SCN8A in a Patient with Cerebellar Atrophy, Ataxia, and Mental Retardation. J. Med. Genet.. 43, 527-530.

  58. Wasserman, D., Geijer, T., Rozanov, V., and Wasserman, J. (2005) Suicide Attempt and Basic Mechanisms in Neural Conduction: Relationships to the SCN8A and VAMP4 Genes. Am. J. Med. Genet. B. Neuropsychiatr. Genet.. 133B, 116-119.

  59. McKinney, B. C., Chow, C. Y., Meisler, M. H., and Murphy, G. G. (2008) Exaggerated Emotional Behavior in Mice Heterozygous Null for the Sodium Channel Scn8a (Nav1.6). Genes Brain Behav.. 7, 629-638.

  60. Martin, M. S., Tang, B., Papale, L. A., Yu, F. H., Catterall, W. A., and Escayg, A. (2007) The Voltage-Gated Sodium Channel Scn8a is a Genetic Modifier of Severe Myoclonic Epilepsy of Infancy. Hum. Mol. Genet.. 16, 2892-2899.

  61. Yu, F. H., Mantegazza, M., Westenbroek, R. E., Robbins, C. A., Kalume, F., Burton, K. A., Spain, W. J., McKnight, G. S., Scheuer, T., and Catterall, W. A. (2006) Reduced Sodium Current in GABAergic Interneurons in a Mouse Model of Severe Myoclonic Epilepsy in Infancy. Nat. Neurosci.. 9, 1142-1149.

  62. Craner, M. J., Hains, B. C., Lo, A. C., Black, J. A., and Waxman, S. G. (2004) Co-Localization of Sodium Channel Nav1.6 and the Sodium-Calcium Exchanger at Sites of Axonal Injury in the Spinal Cord in EAE. Brain. 127, 294-303.

  63. Craner, M. J., Newcombe, J., Black, J. A., Hartle, C., Cuzner, M. L., and Waxman, S. G. (2004) Molecular Changes in Neurons in Multiple Sclerosis: Altered Axonal Expression of Nav1.2 and Nav1.6 Sodium Channels and Na+/Ca2+ Exchanger. Proc. Natl. Acad. Sci. U. S. A.. 101, 8168-8173.

  64. Rush, A. M., Dib-Hajj, S. D., and Waxman, S. G. (2005) Electrophysiological Properties of Two Axonal Sodium Channels, Nav1.2 and Nav1.6, Expressed in Mouse Spinal Sensory Neurones. J. Physiol.. 564, 803-815.

  65. Duchen, L. W., and Stefani, E. (1971) Electrophysiological Studies of Neuromuscular Transmission in Hereditary 'Motor End-Plate Disease' of the Mouse. J. Physiol.. 212, 535-548.

  66. Harris, J. B., and Pollard, S. L. (1986) Neuromuscular Transmission in the Murine Mutants "Motor End-Plate Disease" and "Jolting". J. Neurol. Sci.. 76, 239-253.

  67. Garcia, K. D., Sprunger, L. K., Meisler, M. H., and Beam, K. G. (1998) The Sodium Channel Scn8a is the Major Contributor to the Postnatal Developmental Increase of Sodium Current Density in Spinal Motoneurons. J. Neurosci.. 18, 5234-5239.

  68. Hilber, K., Sandtner, W., Kudlacek, O., Glaaser, I. W., Weisz, E., Kyle, J. W., French, R. J., Fozzard, H. A., Dudley, S. C., and Todt, H. (2001) The Selectivity Filter of the Voltage-Gated Sodium Channel is Involved in Channel Activation. J. Biol. Chem.. 276, 27831-27839.

  69. Buchner, D. A., Seburn, K. L., Frankel, W. N., and Meisler, M. H. (2004) Three ENU-Induced Neurological Mutations in the Pore Loop of Sodium Channel Scn8a (Na(v)1.6) and a Genetically Linked Retinal Mutation, rd13. Mamm. Genome. 15, 344-351.

  70. Lipkind, G. M., and Fozzard, H. A. (2000) KcsA Crystal Structure as Framework for a Molecular Model of the Na(+) Channel Pore. Biochemistry. 39, 8161-8170.

  71. Yamagishi, T., Li, R. A., Hsu, K., Marban, E., and Tomaselli, G. F. (2001) Molecular Architecture of the Voltage-Dependent Na Channel: Functional Evidence for Alpha Helices in the Pore. J. Gen. Physiol.. 118, 171-182.