Phenotypic Mutation 'stromberg' (pdf version)
Allelestromberg
Mutation Type missense
Chromosome4
Coordinate129,555,640 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Lck
Gene Name lymphocyte protein tyrosine kinase
Synonym(s) Hck-3, p56
Chromosomal Location 129,548,349-129,573,641 bp (-)
MGI Phenotype Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain on SP thymocytes, whose numbers are reduced.
Accession Number

NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000125777]
SMART Domains Protein: ENSMUSP00000125777
Gene: ENSMUSG00000000409
AA Change: E299G

DomainStartEndE-ValueType
SH3 75 131 3.53e-17 SMART
SH2 136 226 2.07e-34 SMART
TyrKc 256 505 2.66e-133 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000167288)
Phenotypic Category decrease in CD4:CD8, decrease in CD4+ T cells, decrease in CD4+ T cells in CD3+ T cells, decrease in CD8+ T cells, decrease in T cells, DSS: resistant day 10, increase in B:T cells, increase in CD44 MFI in CD4, increase in CD44 MFI in CD8, increase in CD8+ T cells in CD3+ T cells, T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization, T-dependent humoral response defect- decreased antibody response to rSFV
Penetrance  
Alleles Listed at MGI

All alleles(22) : Targeted(6) Gene trapped(15) Chemically induced(1

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Lck APN 4 129558146 missense probably benign 0.01
IGL02666:Lck APN 4 129556419 missense probably benign 0.29
iconoclast UTSW 4 129555604 missense probably damaging 1.00
lockdown UTSW 4 129558127 missense probably damaging 1.00
swan UTSW 4 129555640 missense probably damaging 1.00
R0087:Lck UTSW 4 129555729 splice acceptor site probably benign
R0091:Lck UTSW 4 129555681 missense possibly damaging 0.81
R0480:Lck UTSW 4 129555640 missense probably damaging 1.00
R1510:Lck UTSW 4 129555668 missense possibly damaging 0.92
R1569:Lck UTSW 4 129555656 missense possibly damaging 0.95
R1845:Lck UTSW 4 129558086 missense probably benign 0.00
R2001:Lck UTSW 4 129548937 missense probably benign 0.00
R2141:Lck UTSW 4 129548920 missense probably damaging 1.00
R4694:Lck UTSW 4 129548972 missense possibly damaging 0.66
R4737:Lck UTSW 4 129555984 missense possibly damaging 0.93
R5706:Lck UTSW 4 129551638 unclassified probably null
R5712:Lck UTSW 4 129556310 missense probably benign
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository
Last Updated 03/03/2017 10:59 AM by External Program
Record Created 08/07/2013 1:38 PM by Emre Turer
Record Posted 02/23/2017
Phenotypic Description
Figure 1. Stromberg mice exhibit an increased B:T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Stromberg mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Stromberg mice exhibit decreased CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Stromberg mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Stromberg mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Stromberg mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Stromberg mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Stromberg mice exhibit increased expression of CD44 on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Stromberg mice exhibit increased expression of CD44 on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous stromberg mice exhibit diminished T-dependent IgG responses to OVA-alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous stromberg mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

he stromberg phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0480, some of which showed an increase in the B:T cell ratio (Figure 1) due to a decreased frequency of total T cells (Figure 2). Some mice also showed a decrease in the CD4+ to CD8+ T cell ratio (Figure 3) caused by a diminished frequency of CD4+ T cells (Figure 4) and CD4+ T cells in CD3+ T cells (Figure 5) coupled with lesser diminution of CD8+ T cells (Figure 6) and an increase in the frequency of CD8+ T cells in CD3+ T cells (Figure 7). CD44 expression was increased on both CD4+ and CD8+ T cells (Figure 8 and 9, respectively). Some mice showed diminished T-dependent IgG responses to both aluminum hydroxide (alum)-emulsified ovalbumin (OVA) (Figure 10) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11). 

Nature of Mutation
Figure 12. Linkage mapping of the reduced T-dependent IgG response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0480. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 114 mutations.  Three mutations (in Ago4, Lck, and Cnr2) shared equal linkage to all of the above anomalies by continuous variable mapping. The mutation in Lck is presumed to be causative as it shares immune phenotypes with other alleles of Lck (see MGI and the record for iconoclast). The Lck mutation is A to G transition at base pair 129,555,640 (v38) on chromosome 4, equivalent to base pair 18,002 in the GenBank genomic region NC_000070 encoding Lck.  The strongest association was found with a recessive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein 10 variant homozygotes departed phenotypically from 8 homozygous reference mice and 16 heterozygous mice with a P value of 3.568 x 10-18 (Figure 12).

 

The mutation corresponds to residue 953 in the NM_001162432 mRNA sequence in exon 9 of 13 total exons, or at position 995 bp of the NM_001162433 mRNA sequence in exon 9 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 8 of 12 total exons.

 

17986 GACGCCTTCCTGGCTGAGGCTAACCTCATGAAG

294   -D--A--F--L--A--E--A--N--L--M--K- (NM_001162432)

283   -D--A--F--L--A--E--A--N--L--M--K- (NM_001162433)

283   -D--A--F--L--A--E--A--N--L--M--K-  (NM_010693)

 

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a glutamic acid to glycine substitution at position 299 (E299G) in the Lck protein isoform encoded by NM_001162432 and a glutamic acid to glycine substitution at position 288 (E288G) in the Lck protein isoforms encoded by NM_001162433 and NM_010693.

Protein Prediction
Figure 13. The structure of Lck. A, Domain structure of Lck. B, 3D structure of inactive Src. The unique domain is not part of this structure. The position of the stromberg mutation is indicated. Image is interactive; click to see another Lck mutation. UCSF Chimera structure is based on PDB:2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Figure 14. Crystal structure of the kinase domain of human Lck in the active conformation. The position of the stromberg mutation is indicated. UCSF Chimera structure is based on PDB: 3LCK, Yamaguchi and Hendrickson, Nature 384, 484-489 (1996). Click on the 3D structure to view it rotate.

Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 13). The stromberg mutation lies in the N-lobe of the Lck kinase domain (amino acids 238-496), within helix αC [Figure 14(1-4)]. The effect of the mutation on kinase activity, expression level, or localization has not been tested.

 

Please see the record iconoclast for information about Lck.

Putative Mechanism

Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. This event is necessary for the propagation of signals from the TCR. The stromberg mutation lies in the N-lobe of the Lck kinase domain, which may alter the kinase activity.

Primers PCR Primer
stromberg(F):5'- AGGTAAAAGCGCCTTCCTTCCCTG -3'
stromberg(R):5'- AAAGTTGAGCCGTCCTTGCCAG -3'

Sequencing Primer
stromberg_seq(F):5'- CAAAAGGTAGTGGGACCACA -3'
stromberg_seq(R):5'- TTCCCAGGGAAACACTGAAGTTG -3'
Genotyping

Stromberg genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Stromberg(F): 5’- AGGTAAAAGCGCCTTCCTTCCCTG-3’

Stromberg(R): 5’- AAAGTTGAGCCGTCCTTGCCAG-3’

 

Sequencing Primer

Stromberg_seq(F): 5’- CAAAAGGTAGTGGGACCACA-3’
 

Stromberg_seq(R): 5’- TTCCCAGGGAAACACTGAAGTTG -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 532 nucleotides is amplified (Chr. 4: 129555452- 129555983, GRCm38; NCBI RefSeq NC_000070):

 

aggtaaaagc gccttccttc cctgggtcca aaaggtagtg ggaccacaat agcgccctca

agcggctgga catagcaggg cacccaccgt tctccatgta ttccgtgatg atgtagatgg

gttcctgggt gaccactgca taaagccgga ctagccgcgg gtgctgcagc tgcttcatga

ggttagcctc agccaggaag gcgtcggggg acatgctccc ttgtttcaga ctcttcaccg

ccaccttcgt gtgtccgttg tagtaccctg atggggtacg ggtggagaag ttacagaggt

caagatcctg acgaactagg cagccatcct gaataggcca gtgtgagagg aagctcacat

tctctctcct ctttccaatc agtcccgagg gtcacactca cccatccaca cttccccgaa

ctggccagct cccagccgct ccaccaactt cagtgtttcc ctgggaactt cccattcgtc

ctcccaccat ggtttctggg gcttctgggt ctggcaagga cggctcaact tt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. + strand (shown); A>G, sense strand).

References
Science Writers Anne Murray
Illustrators Katherine Timer
AuthorsEmre Turer, Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler