Phenotypic Mutation 'stromberg'

• Allele: stromberg
• Mutation Type: missense
• Chromosome: 4
• Coordinate: 129,449,433 bp (GRCm39)
• Base Change: T ⇒ C (forward strand)
• Gene: Lck
• Gene Name: lymphocyte protein tyrosine kinase
• Synonym(s): Hck-3, p56
• Chromosomal Location: 129,442,142-129,467,415 bp (-) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Aug 2016] ; PHENOTYPE: Mice homozygous for mutations of this gene exhibit thymic atrophy with reduced numbers of peripheral T cells. Null mutants have few double positive and no mature single positive (SP) thymocytes. A hypomorph has decreased expression of CD3epsilon chain onSP thymocytes, whose numbers are reduced. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamic Acid changed to Glycine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000066209] [ENSMUSP00000099656] [ENSMUSP00000119263] [ENSMUSP00000125777]
• AlphaFold: P06240
• SMART Domains: Protein: ENSMUSP00000066209; Gene: ENSMUSG00000000409; AA Change: E288G

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000067240)
• SMART Domains: Protein: ENSMUSP00000099656; Gene: ENSMUSG00000000409; AA Change: E288G

Domain	Start	End	E-Value	Type
SH3	64	120	3.53e-17	SMART
SH2	125	215	2.07e-34	SMART
TyrKc	245	494	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000102596)
• SMART Domains: Protein: ENSMUSP00000119263; Gene: ENSMUSG00000000409

Domain	Start	End	E-Value	Type
PDB:1Q69|B	7	33	9e-12	PDB
SCOP:d1awj__	45	92	2e-8	SMART
PDB:1LCK|A	53	92	3e-20	PDB
Blast:SH3	64	92	4e-13	BLAST

• Predicted Effect: probably benign
• SMART Domains: Protein: ENSMUSP00000125777; Gene: ENSMUSG00000000409; AA Change: E299G

Domain	Start	End	E-Value	Type
SH3	75	131	3.53e-17	SMART
SH2	136	226	2.07e-34	SMART
TyrKc	256	505	2.66e-133	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000167288)
• Meta Mutation Damage Score: 0.9696
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• Last Updated: 2018-01-03 4:44 AM by External Program
• Record Created: 2013-08-07 1:38 PM by Emre Turer
• Record Posted: 2017-02-23
• Science Writers: Anne Murray
• Illustrators: Katherine Timer
• Authors: Emre Turer, Kuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler

Accession Number

NCBI RefSeq: NM_001162432, NM_010693, NM_001162433; MGI:96756

Alleles Listed at MGI

All alleles(22) : Targeted(6) Gene trapped(15) Chemically induced(1) 

Phenotypic Description

Figure 1. Stromberg mice exhibit an increased B:T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Stromberg mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Stromberg mice exhibit decreased CD4+ to CD8+ T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Stromberg mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Stromberg mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Stromberg mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Stromberg mice exhibit increased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Stromberg mice exhibit increased expression of CD44 on CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Stromberg mice exhibit increased expression of CD44 on CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to CD44 expression. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous stromberg mice exhibit diminished T-dependent IgG responses to OVA-alum. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous stromberg mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

he stromberg phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0480, some of which showed an increase in the B:T cell ratio (Figure 1) due to a decreased frequency of total T cells (Figure 2). Some mice also showed a decrease in the CD4+ to CD8+ T cell ratio (Figure 3) caused by a diminished frequency of CD4+ T cells (Figure 4) and CD4+ T cells in CD3+ T cells (Figure 5) coupled with lesser diminution of CD8+ T cells (Figure 6) and an increase in the frequency of CD8+ T cells in CD3+ T cells (Figure 7). CD44 expression was increased on both CD4+ and CD8+ T cells (Figure 8 and 9, respectively). Some mice showed diminished T-dependent IgG responses to both aluminum hydroxide (alum)-emulsified ovalbumin (OVA) (Figure 10) and recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 11). 

Nature of Mutation

Figure 12. Linkage mapping of the reduced T-dependent IgG response to rSFV-β-gal using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0480. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 114 mutations.  Three mutations (in Ago4, Lck, and Cnr2) shared equal linkage to all of the above anomalies by continuous variable mapping. The mutation in Lck is presumed to be causative as it shares immune phenotypes with other alleles of Lck (see MGI and the record for iconoclast). The Lck mutation is A to G transition at base pair 129,555,640 (v38) on chromosome 4, equivalent to base pair 18,002 in the GenBank genomic region NC_000070 encoding Lck.  The strongest association was found with a recessive model of linkage to the normalized T-dependent antibody response to rSFV-β-gal, wherein 10 variant homozygotes departed phenotypically from 8 homozygous reference mice and 16 heterozygous mice with a P value of 3.568 x 10^-18 (Figure 12).

The mutation corresponds to residue 953 in the NM_001162432 mRNA sequence in exon 9 of 13 total exons, or at position 995 bp of the NM_001162433 mRNA sequence in exon 9 of 13 total exons, or at position 1,050 of the NM_010693 mRNA sequence in exon 8 of 12 total exons.

17986 GACGCCTTCCTGGCTGAGGCTAACCTCATGAAG 294   -D--A--F--L--A--E--A--N--L--M--K- (NM_001162432) 283   -D--A--F--L--A--E--A--N--L--M--K- (NM_001162433) 283   -D--A--F--L--A--E--A--N--L--M--K-  (NM_010693)

Genomic numbering corresponds to NC_000070. The mutated nucleotide is indicated in red lettering and results in a glutamic acid to glycine substitution at position 299 (E299G) in the Lck protein isoform encoded by NM_001162432 and a glutamic acid to glycine substitution at position 288 (E288G) in the Lck protein isoforms encoded by NM_001162433 and NM_010693.

Protein Prediction

Figure 13. The structure of Lck. A, Domain structure of Lck. B, 3D structure of inactive Src. The unique domain is not part of this structure. The position of the stromberg mutation is indicated. Image is interactive; click to see another Lck mutation. UCSF Chimera structure is based on PDB:2SRC, Xu et al, Mol. Cell 3, 629-638 (1999). Click on the 3D structure to view it rotate.

Figure 14. Crystal structure of the kinase domain of human Lck in the active conformation. The position of the stromberg mutation is indicated. UCSF Chimera structure is based on PDB: 3LCK, Yamaguchi and Hendrickson, Nature 384, 484-489 (1996). Click on the 3D structure to view it rotate.

Lck encodes lymphocyte protein tyrosine kinase (Lck), a member of the Src family of nonreceptor tyrosine kinases (Figure 13). The stromberg mutation lies in the N-lobe of the Lck kinase domain (amino acids 238-496), within helix αC [Figure 14; (1-4)]. The effect of the mutation on kinase activity, expression level, or localization has not been tested.

Please see the record iconoclast for information about Lck.

Putative Mechanism

Lck functions in one of the first steps in T cell receptor (TCR) signaling, in which it phosphorylates the immunoreceptor tyrosine-based activation motifs (ITAMS) present on the CD3 heterodimer (CD3εγ or CD3εδ) and CD3ζ chains of the TCR. This event is necessary for the propagation of signals from the TCR. The stromberg mutation lies in the N-lobe of the Lck kinase domain, which may alter the kinase activity.

Primers

PCR Primer
stromberg_pcr_F: AGGTAAAAGCGCCTTCCTTCCCTG
stromberg_pcr_R: AAAGTTGAGCCGTCCTTGCCAG

Sequencing Primer
stromberg_seq_F: CAAAAGGTAGTGGGACCACA
stromberg_seq_R: TTCCCAGGGAAACACTGAAGTTG

Genotyping

Stromberg genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Stromberg(F): 5’- AGGTAAAAGCGCCTTCCTTCCCTG-3’

Stromberg(R): 5’- AAAGTTGAGCCGTCCTTGCCAG-3’

Sequencing Primer

Stromberg_seq(F): 5’- CAAAAGGTAGTGGGACCACA-3’
 

Stromberg_seq(R): 5’- TTCCCAGGGAAACACTGAAGTTG -3’

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 532 nucleotides is amplified (Chr. 4: 129555452- 129555983, GRCm38; NCBI RefSeq NC_000070):

aggtaaaagc gccttccttc cctgggtcca aaaggtagtg ggaccacaat agcgccctca

agcggctgga catagcaggg cacccaccgt tctccatgta ttccgtgatg atgtagatgg

gttcctgggt gaccactgca taaagccgga ctagccgcgg gtgctgcagc tgcttcatga

ggttagcctc agccaggaag gcgtcggggg acatgctccc ttgtttcaga ctcttcaccg

ccaccttcgt gtgtccgttg tagtaccctg atggggtacg ggtggagaag ttacagaggt

caagatcctg acgaactagg cagccatcct gaataggcca gtgtgagagg aagctcacat

tctctctcct ctttccaatc agtcccgagg gtcacactca cccatccaca cttccccgaa

ctggccagct cccagccgct ccaccaactt cagtgtttcc ctgggaactt cccattcgtc

ctcccaccat ggtttctggg gcttctgggt ctggcaagga cggctcaact tt

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (T>C, Chr. + strand (shown); A>G, sense strand).

References

  1. Xu, W., Harrison, S. C., and Eck, M. J. (1997) Three-Dimensional Structure of the Tyrosine Kinase c-Src. Nature. 385, 595-602.

  2. Sicheri, F., Moarefi, I., and Kuriyan, J. (1997) Crystal Structure of the Src Family Tyrosine Kinase Hck. Nature. 385, 602-609.

  3. Sicheri, F., and Kuriyan, J. (1997) Structures of Src-Family Tyrosine Kinases. Curr Opin Struct Biol. 7, 777-785.

  4. Yamaguchi, H., and Hendrickson, W. A. (1996) Structural Basis for Activation of Human Lymphocyte Kinase Lck upon Tyrosine Phosphorylation. Nature. 384, 484-489.