Phenotypic Mutation 'Tigris' (pdf version)
AlleleTigris
Mutation Type missense
Chromosome7
Coordinate122,424,977 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Prkcb
Gene Name protein kinase C, beta
Synonym(s) Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
Chromosomal Location 122,288,751-122,634,402 bp (+)
MGI Phenotype Mice homozygous and/or heterozygous for ENU-induced mutations exhibit abnormal B cell morphology and physiology, decreased IgM levels and reduced antibody response to a model T cell-independent antigen.
Accession Number

NCBI RefSeq: NM_008855; MGI: 97596

Mapped Yes 
Amino Acid Change Histidine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000070019]
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: H75L

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 1.80; Specificity: 1.00)
(Using ENSMUST00000064989)
Phenotypic Category T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All mutations/alleles(5) : Chemically induced (ENU)(2) Targeted(3)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
Tilcara APN 7 122595005 missense probably damaging 1.00
IGL02045:Prkcb APN 7 122590167 missense possibly damaging 0.85
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site 0.00
IGL02962:Prkcb APN 7 122425047 splice site 0.00
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null 0.00
Almonde UTSW 7 122582449 missense probably damaging 1.00
Untied UTSW 7 122582439 missense probably damaging 1.00
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1560:Prkcb UTSW 7 122458033 splice acceptor site probably benign
R1823:Prkcb UTSW 7 122568124 splice acceptor site probably benign
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4754:Prkcb UTSW 7 122600740 missense noncoding transcript
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice
MMRRC Submission 038155-MU
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created 08/20/2013 6:38 PM by Kuan-Wen Wang
Record Posted 01/28/2015
Phenotypic Description

Figure 1. Tigris mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Tigris phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0409, some of which showed a diminished T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) (Figure 1). 

Nature of Mutation
Figure 2. Linkage mapping of the reduced T-independent antibody response to NP-Ficoll using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 54 mutations (X-axis) identified in the G1 male of pedigree R0409.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 54 mutations. The diminished T-independent antibody response to NP-Ficoll was linked by continuous variable mapping to a mutation in Prkcb: an A to T transversion at base pair 122,424,977 (v38) on chromosome 7, or base pair 135,898 in the GenBank genomic region NC_000073. Linkage was found with an additive model of linkage (P = 8.08 x 10-4), wherein two variant homozygotes and nine heterozygotes departed phenotypically from five homozygous reference mice (Figure 2). The mutation corresponds to residue 444 in the mRNA sequence NM_008855 within exon 3 of 17 total exons.

 

428 TGCTGCTTTGTTGTACACAAGCGCTGCCATGAG

70  -C--C--F--V--V--H--K--R--C--H--E-

 

The mutated nucleotide is indicated in red.  The mutation results in a histidine (H) to leucine (L) substitution at position 75 (H75L) in the PKCβ protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.966).

Protein Prediction

Figure 3. Domain structure of conventional PKCs (amino acid numbering is for PKCβII). Key features of the regulatory domain include the pseudosubstrate motif (PS), the DAG-binding C1 domain, and the calcium-binding C2 domain. The kinase domain consists of the ATP-binding C3 domain, the substrate-binding domain and the V5 region. Key phosphorylation sites necessary for PKC activity are indicated in orange ovals. The residue altered by the Tigris mutation is shown in red. C, conserved region; V, variable region. Click on the image to view other mutations found in PRKCB. Click on each mututation for more specific information.

PKCβ is a member of the protein kinase C (PKC) family of serine-threonine kinases. The PKC family belongs to the AGC-type kinase (protein kinase A/protein kinase G/protein kinase C) superfamily. PKC kinases share certain structural features including a highly conserved catalytic domain consisting of motifs required for ATP-substrate binding and catalysis, and a regulatory domain that maintains the enzyme in an inactive conformation. The regulatory and catalytic domains are attached to each other by a hinge region (Figure 3). Conventional PKCs (cPKCs) contain five variable (V) domains and four conserved (C) domains.  In PKCβ isoforms, the C1 domain occurs at residues 36-151 and can be subdivided into an A and B domain, each containing a characteristic DAG-binding motif, HX12CX2CXnCX2CX4HX2CX7C, where H is histidine, C is cysteine, X is any other amino acid, and n is 13 or 14 (1).

 

The Tigris mutation results in the substitution of a histidine for a leucine at amino acid 75 within the C1A domain.

 

Please see the record Untied for information about Prkcb.

Putative Mechanism

In B cell receptor signaling, PKCβ functions to upregulate NF-κB activity and to promote B-cell activation, PKCβ can also directly inhibit Btk through a negative feedback loop (2). PKCβ specifically phosphorylates Btk at Ser180 within its Tec-homology (TH) region, leading to an inhibition of Btk membrane translocation and activation, and the downstream events that promote PKCβ activation. PKCβ activity also appears to play a role in mediating B cell activating factor (BAFF)-induced signals leading to B cell survival by phosphorylating the Akt kinase (also known as protein kinase B or PKB) and contributing to its activation. 

 

A targeted knockout of the Prkcb gene in mice resulted in animals with reduced numbers of mature peripheral B cells, a loss of peritoneal B-1 B cells, reduced T cell-independent antibody responses, as well as reduced function of various other immune cell types. The reduction of B cell antibody responses to TNP-Ficoll in Tigris mice suggests that the function of B-1 and/or MZ B cells is impaired in these animals with BCR signaling likely affected.  These phenotypes are consistent with the phenotypes observed in Prkcb-/-animals, which also exhibit reduced T cell-independent antibody responses along with severe impairment of B-1 cells (3).  The semidominant phenotype observed in Tigris mice may be due to the expression of nonfunctional, but appropriately localized, PKCβ proteins that are then able to inhibit the appropriate localization and function of wild type kinases.

Primers PCR Primer
Tigris(F):5'- ATGTGTGCAGTGGAGCCAGGTA -3'
Tigris(R):5'- GCACGATCAGAGTGAGGTCCTAGT -3'

Sequencing Primer
Tigris_seq(F):5'- tcctgtctctgcctcctg -3'
Tigris_seq(R):5'- CAGAGTGAGGTCCTAGTTGTTTCC -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler