Phenotypic Mutation 'whitemouse' (pdf version)
Allelewhitemouse
Mutation Type missense
Chromosome7
Coordinate56,414,431 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Oca2
Gene Name oculocutaneous albinism II
Synonym(s) D7H15S12, p, D7H15S12
Chromosomal Location 56,239,760-56,536,518 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM_021879; MGI: 97454
Mapped Yes 
Amino Acid Change Tryptophan changed to Arginine
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: W725R

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000032633)
Predicted Effect probably benign
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.235) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100 % 
Alleles Listed at MGI
All alleles(66) : Gene trapped(1) Spontaneous(19) Chemically induced(7) Radiation induced(39)
Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Mode of Inheritance Autosomal Recessive
Local Stock Embryos
Repository

none

Last Updated 2018-01-12 4:38 PM by Diantha La Vine
Record Created unknown
Record Posted 2008-04-10
Phenotypic Description
The whitemouse mutation was induced by an N-ethyl-N-nitrosourea (ENU)-mutagenesis on a C57BL/6J (black) background and was discovered in G3 animals.  Whitemouse is a strictly recessive phenotype with a light coat color and ocular albinism, similar to the phenotype created by mutations at the Oca2 or p (pink-eyed dilution) locus.  Mutations at Oca2 are known to cause a reduction of eumelanin (black-brown) pigment and altered morphology of black pigment granules (eumelanosomes), but have little effect on pheomelanin (yellow-red) pigment (1;2).
 
Due to a high resemblance in their phenotypes, snowflake and whitemouse mutants were tested for allelism and found to be allelic.  Since both mutations mapped to Chromosome 7, and are similar to classical p locus phenotypes, sequencing of the p locus was undertaken at the genomic level and the causative mutation was identified for both snowflake and whitemouse mutants.

 

Nature of Mutation
The whitemouse mutation was mapped to Chromosome 7, and corresponds to a T to A transversion at position 2303 of the Oca2 transcript, in exon 21 of 24 total exons. 
 
2288 ATTGTCCTGATAGTGTGGGTCTCAGCCTTGGCA
720  -I--V--L--I--V--W--V--S--A--L--A-
 
The mutated nucleotide is indicated in red lettering and results in a tryptophan to arginine change at amino acid 725 in the OCA2 protein.
Protein Prediction
Figure 1. Domain organization and function of the OCA2 protein. A, Topography. B, Domain structure. The whitemouse mutation results in a tryptophan to arginine change at amino acid 725 in the OCA2 protein. Other mutations found in OCA2  are noted in red. This image is interactive. Click on the mutations for more specific information.

The whitemouse mutation occurs in the tenth transmembrane domain of the OCA2 protein (Figure 1).  It is unknown whether normal levels of the altered OCA2 protein exist in whitemouse mice or whether this protein is localized appropriately.

 
Please see the record for quicksilver for information about Oca2.
Putative Mechanism
The whitemouse mutation substitutes a polar, highly basic arginine for nonpolar, neutral tryptophan at amino acid 725 of the OCA2 protein.  This substitution occurs at a residue conserved between mouse and human in the tenth transmembrane region.  Arginine can form multiple hydrogen bonds and can be methylated, unlike tryptophan which contains an indole functional group.  Presumably, the substitution of a neutral, nonpolar hydrophobic residue with highly basic arginine interferes with the formation of the tenth transmembrane region and the function of the OCA2 protein.  Human mutations in the same region cause oculocutaneous albinism II (OCA2, OMIM #203200).  The lighter coat color of snowflake and whitemouse mutants suggest that the mutations present in these animals more severely impair OCA2 protein function than the mutations present in the darker quicksilver, faded, or charbon mice.
 
For a further explanation of the whitemouse mutant phenotype, please refer to the record for quicksilver.
Primers Primers cannot be located by automatic search.
Genotyping
Whitemouse genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
White(F): 5’-AGCACTGACGGGAGCCTACTTTAC-3’
White(R): 5’-CTCTAAGCACTCTTTGGCCCTGAAC-3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
White_seq(F): 5’- CAAGGTATAGGTATGGCCCTC-3’
White_seq(R): 5’- CAACAGAGGAGCTGGTTTCA-3’
 
The following sequence of 1181 nucleotides (from Genbank genomic region NC_000073 for linear DNA sequence of Oca2) is amplified:
 
174131            agcactgacg ggagcctact ttaccctggg taacctagag atgaagggga
174181 tacttgtcaa ataatataca attatagatg cttgctatct tgcttttgcc tttagttaca
174241 gtaagtctaa aaaggagtag cacatagtaa gtgaatgctg cagaaattcc catcttagga
174301 ttctgctggg ccaatctgtg tggtcatcag atgttagtaa gtaatgtaca tttttcctca
174361 catagagcta tttggctgag aatggctcct ctccagttac ttgtggccaa ggtataggta
174421 tggccctcat ttgcatatct atgcttacct gggtcttatc atgtatcaga agaaagagta
174481 acaatctttt gactcttttt gtgtatatgg tttagtattg cagtagttaa tgcataatgt
174541 ggctatcatc attttgtgta tatggtttag tattgcagta gttaatgcat aatgtggcta
174601 tcatcatttt agatggttcc agaagatcag cgctttgcag ctgccattgt cctgatagtg
174661 tgggtctcag ccttggcatc atccttgatt gacaacatcc catttactgc tacgatggta
174721 agtggtgtga tccgtgtgtt taaggccaag ctctacctgt tcctatctgg gctcatcctt
174781 tttctcccta agaagcaggg catgaaacca gctcctctgt tgcccttaca tgtaagggga
174841 aaatgtgagc agctggatac ggaacactta gcgaacagtt acaggctgga gaccaggctt
174901 tggagagtgg acagcatatc atggtcactg cctgtttggg gagcccagtt gagggctgct
174961 acccttccca gaaaaaaaaa aagtttcatt ttttttcaaa ggaaatacaa gaaaccaaaa
175021 gtctgagctg ttgccttcat ttttcctcaa atgcagaagt tatttattct aagcagcctg
175081 aatggattct ggtacttggc ctgtacatat agagatttaa gtctcctttt gattctaact
175141 cccaaccaac accaagaccc ctatctctgg gctatcttct tcgtcattga ttgtttgtct
175201 taggacagga actgtggtct ttggtgtgaa aaaaatcaaa gtgagaatag agatttaaag
175261 gtaagatctg agtcctgcca caaacagttc agggccaaag agtgcttaga g
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsSophie Rutschmann, Bruce Beutler
Edit History
2011-01-07 9:36 AM (current)
2010-10-01 10:39 AM
2010-10-01 10:37 AM
2010-02-03 9:31 AM