Phenotypic Mutation 'lentil' (pdf version)
Allelelentil
Mutation Type missense
Chromosome2
Coordinate121,251,868 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Trp53bp1
Gene Name transformation related protein 53 binding protein 1
Synonym(s) 53BP1, p53BP1
Chromosomal Location 121,193,281-121,271,407 bp (-)
MGI Phenotype Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas.
Accession Number

NCBI RefSeq: NM_013735, NM_001290830; MGI:1351320

Mapped Yes 
Amino Acid Change Alanine changed to Serine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000106277] [ENSMUSP00000106278] [ENSMUSP00000120451] [ENSMUSP00000114457]
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: A317S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably null

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
(Using ENSMUST00000110647)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: A317S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably null

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
(Using ENSMUST00000110648)
Predicted Effect probably null

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)
(Using ENSMUST00000129752)
SMART Domains Protein: ENSMUSP00000114457
Gene: ENSMUSG00000043909
AA Change: A317S

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Predicted Effect probably null

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
(Using ENSMUST00000131245)
Phenotypic Category decrease in CD4+ T cells, decrease in IgD MFI in B cells, decrease in T cells, increase in B:T cells, increase in CD44 MFI in T cells
Penetrance  
Alleles Listed at MGI

All alleles(30) : Targeted(3) Gene trapped(26) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 unclassified probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.98
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.27
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.54
chives UTSW 2 121251868 missense probably null 0.03
concur UTSW 2 121270319 intron
lentil2 UTSW 2 121207887 missense
verily UTSW 2 121211313 missense
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.14
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.14
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.14
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.14
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice acceptor site noncoding transcript
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.14
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice donor site noncoding transcript
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.98
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 nonsense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4960:Trp53bp1 UTSW 2 121216027 missense silent
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 intron probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.98
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.28
R5271:Trp53bp1 UTSW 2 121221263 missense probably null
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
X0065:Trp53bp1 UTSW 2 121200293 splice donor site noncoding transcript
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice
Repository

MMRRC: 37537

Last Updated 09/04/2017 3:43 PM by Diantha La Vine
Record Created 08/20/2013 7:13 PM by Kuan-Wen Wang
Record Posted 02/24/2017
Phenotypic Description
Figure 1. Lentil mice exhibit decreased IgD mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine the IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Serum concentrations of IgM, IgG1, IgG2b, IgA, and IgE in 12-wk-old Trp53bp1−/− mice and WT littermates. Data points represent individual mice. P values were determined by Student’s t test. Results are representative of more than three independent experiments with at least n = 3 mice/genotype. Error bars indicate SD. Figure adapted from (1).

The lentil phenotype was initially identified among G3 mice of the pedigree R0522, some of which exhibit a decrease in the mean fluorescence intensity (MFI) of IgD on B cells in the peripheral blood (1) (Figure 1). The lentil mice exhibit reduced levels of other immunoglobulins compared to wild-type mice (1) (Figure 2).

 

Nature of Mutation

Figure 3. Linkage mapping of reduced IgD MFI using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted againts the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R0522.  Normalized phenotypic data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 4. Trp53bp1-CRISPR mice exhibit decreased IgD mean fluorescence intensity (MFI). Flow cytometric analysis of peripheral blood was utilized to determine the IgD MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. RT-PCR analysis of Trp53bp1 in lentil. (A) The Trp53bp1 cDNA and the primer binding sites usinged in RT-PCR and sequencing are shown. The forward primer is within exon 6 and the reverse primer is in the exon 9; the forward sequencing primer is also within exon 6. (B) RT-PCR results using the primers shown in (A).

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The reduced IgD MFI phenotype was linked by continuous variable mapping to mutations in Trp53bp1, Pla2g4b, and Gpr176 (Figure 3).  A CRISPR-mediated Trp53bp1 knockout mouse model recapitulated the lentil phenotype, confirming that Trp53bp1 is the causative mutation in lentil (P = 1.003 x 10-14Figure 4). The mutation in Trp53bp1: a G to T transversion at base pair 121,251,868  (v38) on chromosome 2, or base pair 23,096 in the GenBank genomic region NC_000068. Linkage was found with a recessive model of inheritance (P = 1.715 x 10-6), wherein 10 affected variant homozygotes departed phenotypically from 10 homozygous reference mice and 19 heterozygous mice. The mutation corresponds to residue 1,078 in the mRNA sequence NM_013735 within exon 8 of 28 total exons.

 

RT-PCR and sequencing analysis were used to examine Trp53bp1 splicing in lentil blood. Using primers spanning exons 6-9 (5’-CTTCATCACAGTTGGGCTTTGG-3’; 5’-GTGGAAAGACTCTCCTGAACAAGG-3’) (Figure 5A), RT-PCR showed a smaller molecular weight Trp53bp1 band in the blood of homozygous lentil mice than that in wild-type mice (Figure 5B). Sequence analysis (primer: 5’-CTTTGGAGTTCTGGAACTGTCC-3’) determined that the cDNA amplified from lentil blood contained a 106-bp deletion within the 167-bp exon 8 (ENSMUST00000110648), indicating that the lentil mutation abolishes the function of the intron 8 donor splice site. The predicted mutation effect is illustrated, below. The 106-bp deletion within exon 8 results in a frameshift that creates a premature stop codon in exon 11 (aberrant amino acids after position 285, truncation after position 362).

 

            <--exon 7                  <--exon 8-->                   intron 8-->     exon 9-->          exon 11 -->

898 ...CTACCACTTGTAAG GTCCGAAGACCGG...CAGGTACCTGCCCGG...AGTAGTAAAACAG gtagggaggctg... CTTCTG...TTTCCAC...ATGAGCCCATGGATATGTCAGTGA

257 ...-L--P--L--V--S --S--E--D--R-...-Q--V--P--A--R-...-S--S--K--T--                 -L--L-...-F--P--...-M--S--P--W--I--C--E--* 363

          correct                 correct                  deleted                                    aberrant

 

The donor splice site within intron 8 is shown in blue and the mutated nucleotide is indicated in red. 

Protein Prediction
Figure 6. Domain structure of 53BP1. The lentil mutation (A317S) is indicated in red. See the text for more details on the domains of 53BP1. Abbreviations: KBD, kinetochore-binding domain; OLIGO, oligomerization domain; GAR, glycine/arginine-rich region; UDR, ubiquitin-dependent recruitment motif; NLS, nuclear localization signal; BRCT, BRCA1 C-terminus. The phosphoinositide 3-kinase-like kinase (PIKK) S/TQ phosphorylation sites are labeled (Ser6, Ser25, Ser29, Ser166, Ser176/Ser178, Thr302, Ser452, Ser831, and Ser1219) as well as the site of ubiquitination (Lys1523).
Figure 7. The solution structure of the mouse tandem Tudor domains. Amino acids 1463-1617 were solved using nuclear magnetic resonance (NMR). Image is interactive; click to rotate. See the text for more details. Figure adapted from PDB:1SSF using UCSF Chimera.
Figure 8. Human tandem BRCT domains bound to p53. Crystal structure includes amino acids 1724-1974 of human 53BP1. Image is interactive; click to rotate. See text for more details. Figure adapted from PDB:1GZH using UCSF Chimera.

Trp53bp1 (transformation related protein 53 binding protein 1) encodes 53BP1, a protein initially identified as one of two binding partners of p53 (2). 53BP1 has two tandem Tudor domains at amino acids 1475-1575 (3) (alternatively, amino acids 1469-1574 (4) or amino acids 1480-1601, SMART) [Figure 6; (5;6)]. The Tudor domains are required for several 53BP1-mediated functions including immunoglobulin (Ig) class switch recombination (CSR), non-homologous end joining (NHEJ), and DNA end protection (7;8). It has not been determined if the Tudor domains are required for the checkpoint or tumor suppression functions of 53BP1 (7). See the “Background” section for more details on the functions of 53BP1.

 

The Tudor domains are members of the SH3-like superfold family and are often found in proteins with functions in signal transduction, nucleic acid binding, transcriptional regulation, chromatin remodeling, and DNA repair (3;9). The solution structure of a 53BP1 fragment containing the mouse tandem Tudor domains (amino acids 1463-1617) has been solved using nuclear magnetic resonance (NMR) [Figure 7; PDB:1SSF; (3)]. The Tudor domains have three structural motifs corresponding to amino acids 1475-1520, 1527-1575, and 1576-1586 (3). The first and second motifs contain two strongly bent antiparallel β sheets and are tightly packed into a β-barrel-like fold connected by a six-residue linker, while the third motif forms an α-helix (3). Gly1508 in motif 1 and Gly1562 in motif 2 mediate the formation of β-turns between the third and fourth β-strands (3). 53BP1 can bind to either linear double- or single-strand DNA substrates (3). DNA binds to the 53BP1 tandem Tudor domain fragment through a surface formed by loops β1β2 and β3β4 in motif 1 (3). Loop β1β2 of motif 1 is also involved in the interaction with RG-rich peptides (3). The structure of motif 2 is affected by DNA binding, indicating that it is also involved in DNA binding (3).

 

The 53BP1 Tudor domains interact with methylated histone residues at the sites of double-strand DNA breaks (DSBs) (3;6). Huyen et al. determined that the 53BP1 Tudor domain binds to constitutively di-methylated histone H3 at lysine 79 (H3K79me2) both in vitro and in vivo to mediate focal recruitment (6).  In a separate study, Botuyan et al. determined that the 53BP1 Tudor domains associate with constitutively di-methylated histone H4 at lysine 20 (H4K20me2) with strong affinity, but an association with H3K79me2 was negligible (10;11). Fitzgerald et al. propose that the different findings in these studies is due to genomic instability generated during transformation that altered the relative importance of H3K79me2 and H4K20me2 in the transformed cell lines used [reviewed in (12)]. In higher eukaryotes, H4K20me2 and H3K79me2 may have overlapping or redundant roles [reviewed in (12)]. Asp1521 (human 53BP1) is required for 53BP1 association with H4K20me2  and subsequent 53BP1-associated formation of DNA damage foci in response to ionizing radiation (IR) and CSR (10). The solution structure of the human Tudor domain in complex with a H4K20me2 peptide (residues 14-27) has been solved by NMR [PDB:2LVM; (13)]. After binding of the H4K20me2peptide, the chemical shifts of Tyr1502, Phe1519, Asp1521, and Tyr1523 changed (13). Tang et al. noted that Tyr1502, Phe1519, Asp1521, and Tyr1523 form the binding cage for H4K20me2 (13). In addition, a direct charge-charge interaction was identified between H4K16 and Glu1551 in 53BP1 that may be a method of regulation with respect to H4 binding proteins (13). Binding of 53BP1 to H4K20me2 facilitates the interaction of 53BP1 with the H2AK15ub epitope (14). Amino acids 1604-1631 (human 53BP1) comprise a ubiquitin-dependent recruitment (UDR) motif that interacts with an epitope formed by H2AK15ub and its surrounding residues on the H2A tail (14). The UDR, along with the Tudor domains facilitate the binding of the 53BP1 dimer to nucleosomes (14). Mutation of Ile1617, Leu1619, Asn1621, Leu1622, and Arg1627 to alanines prevented 53BP1 recruitment to DSB sites; the Ile1627Ala and Leu1619Ala mutations had the strongest impact on 53BP1 recruitment (14). Previous studies had determined the importance of Leu1619 and Leu1622 on 53BP1 recruitment (15). Mutation of all five sites impaired IR-induced foci formation (14).

 

Amino acids 1220-1601 of 53BP1 comprise a kinetochore-binding domain (KBD) (3;16). A nuclear localization signal (NLS; amino acids 1645-1703) and the KBD are sufficient to target 53BP1 to IR-induced foci (IRIF) (4). Deletion of the KBD resulted in loss of IRIF formation (17). Within the KBD, amino acids 1231–1270 are required for homo-oligomerization (15). The oligomerization domain is required for CSR and V(D)J (variable (V), diversity (D), and joining (J)) recombination, but is not required for chromatin binding (8). In cells expressing a mutant 53BP1 that lacked the oligomerization domain, telomeric fusions were reduced by 30-40% compared to the control due to the absence of cells with the longest multichromosome fusion products (18). Amino acids 1288-1409 are required for the interaction of 53BP1 with the breast cancer 1 early-onset (BRCA1) C-terminus (BRCT) domains of mediator of DNA damage checkpoint 1 (MDC1) (19).

 

53BP1 has two tandem BRCT domains at amino acids 1708-1969 (alternatively, amino acids 1723-1951, SMART) (8). BRCT domains are found in many proteins that function in DNA repair, DNA damage response signaling, and cell cycle checkpoints including BRCA1 and MDC1 (20;21). The BRCT domains of 53BP1 mediate protein-protein interactions, including that of 53BP1 with EXPAND1, a protein that promotes chromatin changes after DNA damage to facilitate repair (22;23), and that of 53BP1 with p53 (2;24;25). The crystal structure of the human BRCT domains (amino acids 1724-1974) bound to a heterodimer of the DNA binding region of p53 (amino acids 95-292) has been solved (Figure 8; PDB:1GZH) (24). The BRCT domains fold into a central four-stranded β-sheet with a pair of α-helices (α1 and α3) at one face and a single helix (α2) at the opposite face of the sheet; the β-sheet is the core of the structure (24). The α1 helix forms hydrophobic interactions with amino acids from β1 and β2, while the α2 helix interacts with β4 through hydrophobic interactions (24). Arg1813 and Asp1790 form hydrogen bonds to stabilize the α2/β4 interaction (24). The α1 and α3 helices form a two-helical bundle through hydrophobic interactions. A tryptophan in α3 interacts with residues from β1, β3 and β4. The inter-domain linker (amino acids 1851-1860) is a β-hairpin followed by an extended structure (amino acids 1861-1867). The DNA bound to a structural motif extending from helix α3 of the N-terminal BRCT and including the linker region between the two BRCT domains (24). The C-terminal BRCT domain extends away from the p53 interaction surface (24). Specific deletion of the BRCT domains (53BP1ΔBRCT), determined that the BRCT domains are dispensable for CSR, NHEJ, and protection of DNA ends from resection (8). However, a mutant that lacks the BRCT domains is deficient for the repair of DSBs in heterochromatin (26;27).

 

53BP1 undergoes several posttranslational modifications. Human 53BP1 has 32 phosphoinositide 3-kinase-like kinase (PIKK) Ser/Thr-Gln (S/TQ) consensus sites. Following IR, ten of the sites (Ser6, Ser25, Ser29, Ser166, Ser176/Ser178, Thr302, Ser452, Ser831, and Ser1219) are phosphorylated by a PIKK (e.g., ATM) (28-30). The S/TQ phosphorylation sites of 53BP1 are required for the accumulation of Rif1, a mediator of 53BP1 function in the suppression of end resection at deprotected telomeres (31-33). Callen et al. propose that a major Rif1 interaction motif is C-terminal to the eight S/TQ PTIP interaction sites (34). Ser25/29 are phosphorylation targets of ATM after DNA damage and are required to prevent DNA resection and support CSR (4;8). MDC1 regulates 53BP1 phosphorylation at Ser25/29 after DNA damage (35). Phosphorylation of 53BP1 at Ser25/29 is required for the correct phosphorylation of Chk2 and BRCA1 as well as for the subsequent checkpoint activation (35). However, mutation of the two sites to alanines did not abolish 53BP1 targeting (4). Phosphorylation of Ser25 is required for an interaction between 53BP1 and the BRCT domains of Pax transactivation domain-interacting protein (PTIP); disruption of the interaction leads to DNA-damage-sensitivity and reduced CHK2 phosphorylation (36). Ser1219 phosphorylation is essential for DNA-damage signaling and IR-induced G2/M cell cycle arrest (30). There are also 41 Ser/Thr-Pro (S/TP) cyclin-dependent kinase (CDK) consensus sites in 53BP1, although only four of the CDK consensus sites are known to be phosphorylated (29). The function of CDK-associated phosphorylation of 53BP1 is unknown. Lys1253 of 53BP1 is monoubiquitinated by the E3 ubiquitin ligase RAD18 in vitro, which  retains 53BP1 near DSBs (37). Although initial recruitment of 53BP1 to chromatin is RAD18-independent, the retention of 53BP1 at DSBs requires RAD18-RAD6-associated modification of 53BP1 (37). RAD18 and 53BP1 physically interact in irradiated G1-phase cells, but not S- or G2/M-phase cells (37). After exposure to IR, most 53BP1 is polyubiquitinated and degraded by the ubiquitin-proteaseome system (38). Both the proteasome and cathepsin L (CTSL), a cysteine protease that functions in the endosomal/lysosomal degradation pathway, can induce 53BP1 degradation (39). A-type lamins upregulate CTSL activity, resulting in reduced stability and altered cellular distribution of 53BP1 (39). Overexpression of CTSL in fibroblasts results in the degradation of 53BP1 and subsequent defects in NHEJ (39).

 

53BP1 has a highly conserved glycine/arginine-rich region (GAR; RGRGRRGR; amino acids 1380-1386) (3;4). GARs are often found in RNA processing factors (4). The GAR of 53BP1 is methylated by protein arginine N-methyltranserase 1 (PRMT1), a modification that is proposed to mediate an association of 53BP1 with DNA (40;41).

 

The lentil mutation (A317S) is not within a defined domain in 53BP1. The aberrant splicing in lentil is predicted to code a 362-amino acid protein that would not contain domains that are characteristic of 53BP1 (i.e., the tandem Tudor domains and the tandem BRCT domains); the expression, function, and localization of the 53BP1lentil protein have not been examined.

Expression/Localization

53BP1 was detected in all human tissues tested by Northern blot, except for lung and liver (2). Bothmer et al. detected 53BP1 at chromatin in the absence of DNA damage (8). Iwabuchi et al. determined that in COS-1 cells transfected with HA-tagged 53BP1, the construct localized both in the cytoplasm and nucleus in some cells and only in the nucleus in others (42). The transfected COS-1 cells display two nuclear patterns for 53BP1: homogenous and dot staining (42). 53BP1 exhibits a differential localization pattern through the phases of the cell cycle. During mitosis in HeLa cells, GFP-tagged mouse 53BP1 localized to the kinetochore (16). In the G1 phase of the cell cycle, 53BP1 was localized in a diffuse nuclear pattern as well as in large nuclear “dots” (17). In the S-phase, 53BP1 was localized in a discrete, punctate pattern (17). In the G2 phase, 53BP1 localization was similar to that observed in S-phase cells, but there were fewer loci (17). In interphase, 53BP1 did not colocalize with kintechores (16). During mouse embryonic development, 53BP1 was detected only from the 2-cell stage onwards on chromatin and was absent from mitotic chromosomes (43). In zygotes after fertilization (PN0), 53BP1 was localized only in the cytoplasm and was not associated to the anaphase chromosomes on the female pronucleus or the forming male pronucleus (43). At pronuclear stage PN4, 53BP1 was predominantly cytoplasmic with some localization to the nucleus and pronuclei (43). At the 2-cell stage, 53BP1 exhibited some cytoplasmic localization, but the protein was enriched in the nucleus (43). At the 8-cell stage, 53BP1 exhibited more pronounced enrichment of 53BP1, but some 53BP1 was also detected in the cytoplasm (43). At the morula stage, 53BP1 was excluded from the nucleus and was predominantly cytoplasmic (43). At the blastocyst stage, 53BP1 did not localize to the inner cell mass cells, but 53BP1 was enriched in trophectoderm cells; it was not localized to the nucleus (43). However some cells next to the blastocyst cavity exhibited cytoplasmic and nuclear 53BP1 localization, indicating that changes of cytoplasmic to nuclear 53BP1 localization may be temporally regulated (43).

Background
Figure 9. Factors involved in early DNA DSB-induced signaling. See the text for more details.
Figure 10. Schematic overview of HR and NHEJ DNA DSB repair.  Column A shows key steps in HR of DSBs: (1) PARP senses DSBs, competes with Ku binding to DNA to promote HR, and mediates the recruitment of the MRE11-RAD50-NBS1 (MRN) complex.  MRN-dependent activation of protein kinases results in the recruitment of processing factors that generate 3’ ssDNA overhangs (not shown). (2) The formation of 3’-ssDNA ends leads to the accumulation of the RPA complex, which stabilizes the ssDNA regions, protects the DNA against degradation, and prevents the formation of secondary structures.   (3) The RPA is displaced from the 3’-ssDNA ends; BRCA2-mediated assembly of RAD51 filaments leads to strand invasion into the homologous DNA sequence. (4) Mediators such as RAD51C and XRCC3 allow for the formation of RAD51 filaments, while strand invasion is stabilized by RAD54.  RAD51 and RAD54 catalyze the formation of a displacement loop (D-loop), in which the invading strand primes DNA synthesis. D-loop formation is a branch point to different HR subpathways including break-induced replication (not shown), double Holliday junction formation (not shown), and synthesis-dependent strand annealing (SDSA); all of the subpathways result in the repair of DSB breaks. (5) Fill-in synthesis at the site of the DSB. (6) The results of SDSA is shown. Column B demonstrates selected steps in nonhomologous end joining (NEHJ) repair (see the text for details): (1) Ku associates to DSBs to promote NHEJ and (2) the recruitment of DNA-PKcs to (3) form the catalytically active DNA-PK complex that protects the DNA ends needed for ligation. (4) Autophosphorylation of DNA-PKcs allows for ARTEMIS and DNA pol x family members to access the DNA termini.  ARTEMIS and DNA-PKcs form a complex that cleaves 5’ and 3’ overhangs during NHEJ. DNA pol x family members fill in the gaps with several nucleotides, if necessary, prior to relegation. Nucleases can remove base nucleotides, if necessary (not shown). (5) XRCC4/LIG4 is recruited to the site and the broken ends are religated with the help of XLF.  (6) Repair resolution of the DSB following NHEJ.  Abbreviations: HR, homologous recombination; NHEJ, nonhomologous end joining; DSB, double strand break; PARP; poly(ADP)ribose polymerase; MRN, MRE11-RAD50-NBS1; MRE11, meiotic recombination 11, NBS1, Nibrin or Nijmega breakage syndrome protein 1; ssDNA, single-stranded DNA; BRCA1, breast cancer 1, early onset; RPA, replication protein A; XRCC3, X-ray repair complementing defective repair in Chinese hamster cells 3; SDSA, synthesis-dependent strand annealing; XRCC4, X-ray repair cross-complementing 4; LIG4, DNA ligase IV; XLF, XRCC4-like factor. Figure modified from images found in Ciccia and Elledge. Mol Cell. (2010) 40:179-204, Heyer et al. Annu. Rev. Genet. (2010) 44:113-139, and Neal and Meek. Mutat. Res. (2011) 711:73-86. 
Figure 11. Schematic of class switch recombination. The heavy chain locus has undergone V(D)J recombination and encodes the μ heavy chain. Class switch recombination allows isotype switching in activated B cells. AID induces lesions at the switch regions upstream of an IgH gene which are converted to double-stranded breaks (DSBs). The DSBs recruit factors, including Mre11/Nbs1/Rad50 that are essential for resolution of the break. 53BP1 functions as an anchor downstream of the lesion. In CSR, the mu exon is replaced with another constant region gene (IgG1 shown). Deleted DNA is released as circular DNA. Rectangles and circles represent exons and switch regions, respectively.

53BP1 has several functions including facilitating DNA damage signaling, telomere fusions, NHEJ of DNA double strand break (DSBs) in CSR, transducing ATM-dependent cell cycle checkpoints (intra-S and G2/M), accumulation of p53, phosphorylation of several ATM substrates (e.g., Chk2 and BRCA1) in response to IR, and tumor suppression (7;30;44-49). Several of these functions are described in more detail, below.

 

Several factors are involved in DNA damage response (DDR) signaling including DNA damage sensors, mediators, transducers, and effectors [reviewed in (12)]. The MRN [MRE11 (meiotic recombination 11)–Rad50–NBS1 (Nijmegen breakage syndrome 1)] complex and the PIKKs ATM, ATM and Rad3-related (ATR) and DNA-PK (DNA-dependent protein kinase; see the record for clover) are involved in early DNA DSB-induced signaling [Figure 9; reviewed in (12)]. Mediator/adaptor proteins such as MDC1, BRCA1, PTIP, and 53BP1 facilitate signaling between sensors and transducers to enhance DDR signaling. 53BP1 tethers activated ATM and other repair factors at the site of DSBs (26;27). 53BP1 is required efficient autophosphorylation of ATM at Ser1981 as well as ATM activation in some cell lines (50;51). 53BP1-mediated regulation of ATM-dependent phosphorylation of substrates in response to IR indicates that 53BP1 is a DNA damage checkpoint protein that facilitates ATM phosphorylation events (47). In irradiated U2OS cells, ATM coprecipitated with 53BP1, but not in non-irradiated cells, indicating that the interaction of 53BP1 and ATM is DNA damage-specific (47). DiTullio et al. propose that 53BP1 may function upstream of ATM to activate ATM in response to DSBs, and/or that 53BP1 functions as a scaffold to recruite ATM substrates to ATM at DSBs (47). ATM suppresses end resection in 53BP1-deficient cells in G1, but not in S/G2 phase of the cell cycle (52-54).

 

The recruitment of 53BP1 to DSBs is essential for DDR signaling. An IR-induced DSB induces the phosphorylation of H2AX at Ser139 by PIKKs (ATM/ATR/DNA-PKcs) to form γ-H2AX. 53BP1 subsequently relocates to nuclear foci that colocalize at DSB sites with γ-H2AX (4;7;55), the MRN complex, and BRCA1 (11). The γ-H2AX is not required for initial recruitment of 53BP1 to the foci (56), but is required for sustained retention of these foci (28;48). MDC1 also binds to γ-H2AX via its BRCT domains (57) and the E3 ligases RNF8 and RNF168 are recruited. RNF8 and RNF168 ubiquitinate H2A and/or H2AX (18;58) and mediate the degradation of chromatin proteins (e.g., JMJD2A and L3MBTL1) and/or proteins that bind to H4K20me2 that may compete with 53BP1 (59;60). Focal recruitment of 53BP1 also requires Tip60 histone acetyltransferase activity, which is proposed to facilitate the formation of a more open chromatin structure through histone acetylation (61). The PIKKs transduce the DNA damage signal to transducer kinases such as checkpoint kinase 1 (CHK1) and CHK2, factors that are involved in signal transduction events that target additional DDR components as well as in amplifying the DDR signal. The sensor and transducer kinases phosphorylate downstream effector molecules such as p53 to initiate a biological response.

 

53BP1 has a role in both ATR-Chk1- and ATM-Chk2-associated signaling (62). Although 53BP1 physically interacts with Chk2, the interaction was decreased after IR, resulting in decreased phosphorylation of Chk2, indicating that 53BP1 regulates Chk2 activity [(44); reviewed in (63)]. In addition, siRNA-mediated knockdown of 53BP1 resulted in a ~50% decrease in phosphorylated Chk1 levels one hour after IR exposure (62).

 

The function of 53BP1 in p53-associated activity is conflicting. Iwabuchi et al. proposed that 53BP1 enhances p53-mediated transcription of reporter genes by acting as a transcriptional co-activator of p53 (42). Ward et al. found that without 53BP1 expression, the transactivation activity of p53 was increased, indicating that 53BP1 may negatively regulate p53 function (64). They speculate that differences in earlier studies showing that 53BP1 facilitates p53-mediated transcription are due to artificial 53BP1 overexpression (64). 53BP1 is required for p53 accumulation in response to IR (44), but it is not required for stabilization of p53 or for the IR-induced expression of Mdm2 and p21, downstream p53 factors (64).

 

53BP1 and the type of DSB DNA repair

Homologous recombination (HR) and nonhomologous end-joining (NHEJ) occur upon recognition of a DNA DSB (Figure 10). HR is a relatively error-free mechanism for DSB repair that relies on the homologous region on the sister chromatid as a template for DNA synthesis (65). HR is limited to replicating cells (including early embryonic developmental stages) and can be observed only after DNA replication in the S and G2 phases (66). NHEJ is a rapid repair mechanism that simply ligates broken DNA ends after minimal or no processing. NHEJ occurs in all phases of the cell cycle and is thought to be the primary DNA repair pathway in mammalian cells (67). NHEJ is prone to generating mutations at the point of ligation, and may result in inversions or translocations if the joined strands were not originally contiguous. For a detailed description of NHEJ, please the record for clover.

 

53BP1 functions in the choice of DSB repair. During G1, 53BP1 promotes classic (C)-NHEJ by tethering DSBs together and by protecting the ends from exonuclease processing and subsequent resection of DSBs (52;68). 53BP1 prevents 5’ end resection after DSBs and is critical for CSR in G1, but can lead to genomic instability in the S-phase (34). Exonucleases can generate large deletions that contain long 3’ single-stranded tails that promote homologous recombination (HR) and alternative (A)-NHEJ [(52;53); reviewed in (69)]. A-NHEJ is a repair pathway that occurs when the core C-NHEJ factors (Ku70, Ku80, XRCC4, or Lig4) are absent and generates microhomology-mediated signatures at repair junctions (70); the A-NHEJ pathway is mostly active when DNA ends are poorly protected, such as in the loss of 53BP1 (52). Single-strand overhangs are prominent on telomeres in Trp53bp1-/- cells (46). The loss of 53BP1 results in increased intra-switch region deletions and chromosome translocations, processes mediated primarily by A-NHEJ (71;72). The siRNA-mediated depletion of 53BP1 stimulated HR in U2OS cells (73). In mouse ES cells, siRNA-mediated depletion of 53BP1 led to only a slight increase in HR. 53BP1 does not contribute to NHEJ in V(D)J recombination (45;46;49). Dimitrova et al. propose that the distinction between 53BP1-dependent and –independent NHEJ reactions is due to the distance between the DNA ends involved (46). During NHEJ, 53BP1 is required for long-range joining of distant DNA breaks (68;74). The two ends generated by RAG1/2 or chromosome-internal DNA damage are close in proximity, while the DNA ends generated by activation-induced cytidine deaminase (AID) in CSR as well as the NHEJ-processed dysfunctional telomeres in G1 are far apart (75).

 

53BP1 is required for HR at euchromatin regions and promotes HR specifically at heterochromatin (HC)-DSBs in G2 cells (76). In G2 phase cells 53BP1 has both an inhibitory and pro-HR role (76). The 53BP1 inhibitory role is relieved by BRCA1-dependent repositioning of 53BP1 to the periphery of γ-H2AX foci (76). In the absence of BRCA1, HR does not proceed due to the inhibitory role of 53BP1 (76). 53BP1 is dispensable for HR in S-phase cells as well as in G2 cells after depletion of DNA-PK (76). BRCA1 is structurally similar to 53BP1 at its C-terminus and also functions in ATM-dependent DDR (27;62). BRCA1 and 53BP1 have reciprocal roles in DSB repair: BRCA1 is required for HR, while 53BP1 is required for NHEJ. In S/G2-phase cells, BRCA1 facilitates the removal of 53BP1 from DSBs allowing from resection and DSB repair by HR (53;77;78). In Brca1-deficient mice, the embryonic lethality, tumor predisposition and HR defect (chromosomal abnormalities) phenotypes are rescued by the deletion of Trp53bp1 (53;77;79). In addition, 53BP1 was required for the cellular senescence and apoptosis caused by loss of Brca1 expression (79). The phenotypes associated with Brca1 deficiency, are proposed to be due to an inability to counteract 53BP1-dependent toxic NHEJ in S/G2 (31). Bunting et al. propose that the binding of 53BP1 to chromatid breaks in Brca1-deficient (Brca1-/-) cells prevents HR by partially blocking ATM-dependent resection at the break site, a role that is necessary for HR (53). The loss of 53BP1 (53BP1-/-) in the Brca1-/- cells suppresses the HR defect (53;77). The Brca1-/- /53BP1-/- cells exhibited increased levels of DSBs, intact ATM-Chk2-p53 signaling and IR-induced apoptosis (79)Brca1-/- /53BP1-/- cells have restored HR and genomic stability as well as a resistance to poly(ADP)ribose polymerase inhibitors (PARPi) (13;80). PARP functions in organismal development and DSB repair independent of both H2AX and 53BP1 (81). In Brca1-/- cells, 53BP1 enhances aberrant NHEJ events that create lethal radial chromosomes, due to mis-rejoined DSBs, in response to PARPi (53;82;83). However, upon depletion of 53BP1, the formation of the PARPi-associated lethal radial chromosomes in Brca1-/- cells is prevented.

 

IR-induced cell cycle checkpoints

53BP1 functions in both IR-induced intra-S and the G2/M cell cycle checkpoints in human and mouse cells (44); a role in the G1/S phase checkpoint has not been detected. 53BP1 recruits substrates to the ATM and ATR checkpoint kinases (44). Loss of 53BP1 expression abrogates the ATM-dependent checkpoint response and G2/M cell cycle arrest upon accumulation of IR-induced DNA breaks (53;77). In addition, loss of 53BP1 expression results in partial intra-S phase checkpoint defects following IR treatment (28;44). As a result, there was inappropriate progression into mitosis (35). Minter-Dykhouse et al. propose that 53BP1 functions in the same molecular pathway downstream of ATM as MDC1 (35).

 

V(D)J recombination

V(D)J recombination affects the variable domain of immunoglobulin and T cell receptor (TCR) genes. For a detailed description of V(D)J recombination, please see the record for clover. RAG1/2-induced DNA lesions in antigen receptor loci result in the recruitment of γ-H2AX, NBS1 and 53BP1 (84;85). In v-abl transformed B cells, 53BP1 deficiency does not appreciably affect V(D)J recombination (7). However, in XLF (X-ray repair cross-complementing 4-like factor)-deficient lymphocytes, 53BP1 is required for end ligation during V(D)J recombination (7;86). In Trp53bp1 knockout (Trp53bp1-/-) mice, CSR in the IgH locus was reduced (45;49). In Trp53bp1-/- mice, V(D)J recombination in the TCRα and TCRδ loci were functional, but fewer precursor thymic T cells were observed indicating that loss of Trp53bp1 expression resulted in defective T cell development (68). Joining of the closely spaced D and J segments was not reduced at the TCRδ locus, but complete V(D)J rearrangements over a longer distance were affected by the loss of Trp53bp1 expression (68).

 

Class switch recombination

CSR facilities the production of antibodies of different isotypes in mature B cells during a humoral immune response [Figure 11; (45;49)]. CSR is a recombination reaction that occurs between paired DSBs in immunoglobulin heavy chain (Igh) switch regions (S-regions) that flank Igh constant regions (87). The S-regions contain a repetitive sequence that can serve as a substrate for proximal microhomology-mediated intra-switch repair by C-NHEJ (52;70). During CSR, AID converts cytosines into uracils at the S-region (88). The excision of uracils from both DNA strands results in staggered DNA breaks at donor and acceptor switch regions (88). The IgH locus lesions are detected as DSBs by the MRN complex, which leads to phosphorylation of H2AX, the recruitment of 53BP1 to the IgH locus, and eventual end joining by C- or A-NHEJ (74;84;87). During CSR, 53BP1 facilitates synapsis as well as protects DNA ends from resection (8;88). 53BP1 is required for long-range intra-chromosomal end-joining during CSR and V(D)J recombination (46;49;68;71). ATM-dependent phosphorylation of 53BP1 is essential for the recruitment of Rif1 to DSB sites (31-33). It is unknown whether Rif1 directly binds to 53BP1, or through interactions with effector molecules that contain BRCT domains (34). Rif1 suppresses 5’ end resection at IR-induced DSBs and during CSR in B lymphocytes (31;33;89). Rif1 is not required for 53BP1-associated increased in dysfunctional telomere mobility (33). 53BP1 deficiency results in an almost complete loss of long range CSR and a concomitant increase in the frequency of short-range intra switch recombination (71). Without 53BP1, CSR in lymphocytes is impaired and broken DNA is resected, producing single-stranded DNA that serves as a substrate for repair by A-NHEJ (45;49;52;53;68).

 

Tumor suppression

In mice, 53BP1 has overlapping tumor suppression function with XLF (7) and MDC1 (35).  In the context of p53 deficiency, impaired 53BP1 function alters cancer susceptibility by accelerating the rate of tumorigenesis (90). In Trp53bp1-/-/p53-/-thymic lymphomas, tumorigenesis proceeds through aneuploidy and/or clonal translocations (64;90). Downregulation of 53BP1 expression in BRCA-mutant breast tumors promoted the viability of the cancer cells (53;77).

 

Human Conditions

Dysregulation of TRP53BP1 expression is associated with several human conditions. TRP53BP1 expression in BRCA1-associated breast cancers (53;77),  lymphomas, and solid tumors is reduced (77;91-93). Low levels of TRP53BP1 are correlated with an aggressive form of the disease, correlating with increased metastases and decreased survival [reviewed in (94)]. There is a correlation between loss of TRP53BP1 expression and the triple negative (lacks expression of the estrogen and progesterone receptors as well as the human epidermal growth factor receptor 2 (HER2)) phenotype [reviewed in (94)]. 90% of TRP53BP1-/- tumors are also triple negative; 43% of triple negative tumors are also TRP53BP1-/- [reviewed in (94)]. 53BP1 deficiency and the deregulation of AID, leads to increased DSB formation, resulting in B cell lymphoma (95). Deep sequencing of TRP53BP1-/- cancer cells determined that they exhibited increased DNA end resection compared to wild-type cells (95). Patients with RIDDLE syndrome (OMIM: #611943) lack the ability to recruit 53BP1 to the sites of DNA DSBs (96). Sequencing of the TRP53BP1 gene, and other genes that regulate IR-induced 53BP1 foci formation, did not detect any mutations, indicating that a protein upstream of 53BP1 is impaired (96). Patients with RIDDLE syndrome exhibit immunodeficiency, increased radiosensitivity, mild motor control, learning difficulties, facial dysmorphism, and short stature. Cells from RIDDLE patients are hypersensitive to IR and exhibit cell cycle checkpoint abnormalities as well as impaired end-joining in the recombined switch regions (96). In a patient with RIDDLE syndrome, the IgG and IgM levels were below normal limits by one year of age (96).

 

Trp53bp1 mouse models

Two Trp53bp1 mouse models have been developed. One is a gene-targeted mutation (Trp53bp1-/-Trp53bp1tm1Jc, MGI:2654201) (97), while the other is a random retroviral insertion within intron 13 that prevented exon 13 to properly splice to exon 14, disrupting the Trp53bp1 gene and producing a 1,226 amino acid truncated (tr) 53BP1 protein that does not include the NLS, KBD, and the BRCT domains (m53BP1tr/tr; Trp53bp1Gt(OST94324)Lex, MGI:2661096(17). The m53BP1tr protein was unable to form foci in response to DNA damage and was absent from the nucleus (17). Fibroblasts from the Trp53bp1-/- mice showed no spontaneous chromosomal breaks, however, there was a tendency toward aneuploidy and/or tetraploidy indicating a possible defect in chromosome segregation (97). The m53BP1tr/tr mice also exhibited chromosomal aberrations (17). MEFs from both Trp53bp1-/- and m53BP1tr/tr embryos exhibited reduced proliferation compared to controls (97). Both models are viable, but exhibit growth retardation and increased cellular sensitivity to IR (17;97). The m53BP1tr/tr mice were fertile, but produced smaller litters than wild-type animals (17). After IR, Trp53bp1-/- cells arrested in G2 and exhibited a delayed exit from the G2/M phase; the percentage of mitotic cells 24 hours after IR was lower than wild-type cells (97). Both Trp53bp1 mutant mouse models exhibited lethality 9-15 days after exposure to 7-8 Gy of IR; most wild-type mice were viable for at least 2 months after irradiation (17;97). Necropsy of the Trp53bp1-/- mice revealed radiation-induced intestinal bleeding and bone marrow failure as the cause of death (97). Treatment of the m53BP1tr/tr mice with lower doses of IR (1.5 Gy) did not cause lethality (17). The Trp53bp1 mouse models exhibit immune deficiencies including defects in T cell maturation (17;97). The levels of CD4 T cells, γ–δ T cells, and B cells were all reduced in the Trp53bp1-/- mice with a concomitant increase in the percentage of CD4-CD8progenitors and apoptosis (68;97). In addition, the Trp53bp1-/- thymocytes exhibited an increased number of aberrant cells (either lost Cα (2 TCRVα, 1 TCRCα signal) or both Vα and Cα from one allele (1 TCRVα, 1 TCRCα)) (68). Bone marrow pro-B, pre-B, myeloid, and erthyroid progenitor populations were normal in the m53BP1tr/tr mice (17;49). However, the spleens from the m53BP1tr/tr mice were deficient in mature B cells (IgMloIgDhi(17). IgM levels in the Trp53bp1-/- mice were similar to those in wild-type mice, indicating that B cell activation to mediate IgM secretion is not affected upon loss of 53BP1, however, the levels of all IgG subclasses and IgA were decreased (49). CD4 and CD8 T cell populations were similar between m53BP1tr/tr and wild-type mice, but the progression out of the DNIII stage in development, when β-gene rearrangement occurs, was impaired in the m53BP1tr/tr mice (17). Thymus size in the m53BP1tr/tr mice was smaller and had fewer cells than wild-type mice; the lymphoid organ architecture was normal (17)Trp53bp1-/- mice exhibit premature postnatal lethality between 4 to 7 months due to thymic lymphoma (97). In older Trp53bp1-/- mice, pulmonary carcinoma was also prevalent (64). Heterozygotes exhibited accelerated tumorigenesis (e.g., lymphomas, sarcomas, and carcinomas) in a p53-deficient background (64). Heterozygotes in a p53+/+genetic background also exhibited a higher predisposition to cancer than wild-type mice (64). Cancerous phenotypes in the m53BP1tr/tr mice were not observed (17).

Putative Mechanism

IgD and IgM are the alternatively spliced Igh product made by mature B lymphocytes; IgM and IgD are receptors for antigen on naïve mature B cells (98). IgD is coexpressed with IgM when the cells mature into follicular or marginal zone B cells (98). After exposure to antigens, B cells undergo isotype switching, irreversibly losing IgM and IgD and switching to express the same variable domaine linked to IgG, IgA, or IgE constant region domains. Trp53bp1-/- mice exhibit reduced CSR at the IgH locus [Figure 11; (45;49)] and the spleens from the m53BP1tr/tr mice were deficient in mature B cells (IgMloIgDhi) (17). During CSR, 53BP1 facilitates synapsis as well as protects DNA ends from resection (8;8). In addition, 53BP1 is required for long-range intra-chromosomal end-joining during CSR (46;49;68;74). The levels of IgD on circulating B cells is decreased in lentil, but is difficult to reconcile with an effect on CSR because no such defect is observed in the spleen.  Age-dependency of the low IgD expression is also a peculiar feature of the mutation; notable as well is the observation that in bone marrow transplantation, extrahematopoietic tissues bearing the mutation exert control over the level of IgD expression.

 

In the lentil mice, both A-NHEJ and HR pathways contributed to the increased IgD class-swtich recombination. CSR to IgD requires an intact microbiome and Toll-like receptor signaling, and is confined to B cells of mucosa-associated lymphoid tissues (1).

Primers PCR Primer
lentil(F):5'- AATCCCACGCTTTCCTAGATGCAC -3'
lentil(R):5'- AGTCCTCAAGTTTCTGTTGCTGCTG -3'

Sequencing Primer
lentil_seq(F):5'- GCTGACAAGTAAACACTCTCTG -3'
lentil_seq(R):5'- TGTTGCTGCTGTGGAAACAAAG -3'
Genotyping

Lentil genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Lentil(F): 5’- AATCCCACGCTTTCCTAGATGCAC-3’

Lentil(R): 5’- AGTCCTCAAGTTTCTGTTGCTGCTG-3’

 

Sequencing Primer

Lentil_seq(F): 5’- GCTGACAAGTAAACACTCTCTG-3’
 

Lentil_seq(F): 5’- TGTTGCTGCTGTGGAAACAAAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 29X

6) 72°C             7:00

7) 4°C               ∞

 

The following sequence of 403 nucleotides is amplified (Chr.2: 121251613-121252015, GRCm38):

 

  1 aatcccacgc tttcctagat gcactcctac gtcacctcaa cttccaaaag ggtgaaagct

 61 acacagaacg ctgacaagta aacactctct gacagccctc attactgact ggctagagat      

121 atattttcct tctatatcat tagctattcc aaatcatagc tatttttaaa agtgcttttt      

181 aacagtagcc tcagaactaa aataaaaatg tagaacaagt gagaagagga gctgtggagc      

241 aatcagcctc cctacctgtt ttactactct ggtcaaacaa gtcctcctgg gttgaggaaa      

301 cctcaggctc tgatgacggc tgaacctgcg gcccctcttc cagcagctcc cgggcaggta      

361 cctgttcctt tgtttccaca gcagcaacag aaacttgagg act

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (C>A, Chr. + strand; G>T, sense strand).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsKuan-Wen Wang, Jin Huk Choi, Ming Zeng, Bruce Beutler