Phenotypic Mutation 'juicy' (pdf version)
Allelejuicy
Mutation Type missense
Chromosome18
Coordinate4,339,552 bp (GRCm38)
Base Change A ⇒ C (forward strand)
Gene Map3k8
Gene Name mitogen-activated protein kinase kinase kinase 8
Synonym(s) Tpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
Chromosomal Location 4,331,327-4,353,015 bp (-)
MGI Phenotype Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed.
Accession Number

NCBI RefSeq: NM_007746; MGI: 1346878

Mapped Yes 
Amino Acid Change Leucine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025078]
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: L273R

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
(Using ENSMUST00000025078)
Phenotypic Category TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted(9) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime noncoding transcript
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
Sluggish UTSW 18 4339608 splice acceptor site
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4152:Map3k8 UTSW 18 4332312 missense silent
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038246-MU
Last Updated 09/11/2017 5:23 PM by Diantha La Vine
Record Created 08/25/2013 9:52 AM by Ying Wang
Record Posted 09/12/2014
Phenotypic Description
Figure 1. Juicy mice exhibit decreased TNFα secretion after stimulation with the TLR4 agonist, LPS. Values determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The juicy phenotype was identified among G3 mice of the pedigree R0304, some of which showed diminished LPS-induced TNFα secretion (i.e., defective TLR4 signaling) (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of reduced TNFα secretion after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. The defective TLR4 signaling phenotype was linked by continuous variable mapping to a mutation in Map3k8: a T to G transversion at base pair 4,339,552 (v38) on chromosome 18, or base pair 13,930 in the GenBank genomic region NC_000084. Linkage was found with a recessive model of linkage (P = 4.919 x 10-5), wherein 5 variant homozygotes departed phenotypically from 7 homozygous reference mice and 6 heterozygous mice (Figure 2). The mutation corresponds to residue 942 in the NM_007746 mRNA sequence in exon 5 of 8 total exons.

 

926 TTGGTAGATTTTGGCCTGAGTGTTAAGATGACT

268 -L--V--D--F--G--L--S--V--K--M--T-

 

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to arginine (R) substitution at amino acid residue 273 in the TPL2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 0.989).

Protein Prediction

Figure 3. Domain structure of TPL2 protein. The TPL2 protein contains an N-terminal domain, a kinase domain, and a C-terminal region. A PEST sequence was identified between residues 415 and 438. There is a conserved ATP-binding lysine (K167), and phosphorylation of T290 is required for activation. The juicy mutation (red asterisk) is a leucine (L) to arginine (R) substitution at amino acid residue 273. The image is interactive; click to see another Map3k8 mutation.

Map3k8 encodes TPL2 (tumor progression locus 2)/COT (cancer Osaka thryoid)/MAP3K8, a serine/threonine kinase member of the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins (Figure 3). The Juicy mutation (L273R) is within the kinase domain of TPL2 (amino acids 133-388).

 

Please see the record Sluggish for information about Map3k8.

Putative Mechanism

TPL2 activates the MEK/ERK pathway downstream of most TLRs. Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (1).  Phosphorylation of TPL2 by the IKK complex occurs at T290, and is necessary for both the dissociation of TPL2 from p105, as well as kinase activity (2-4). Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (5-7). The juicy phenotype is similar to that of Map3k8Sluggish/Sluggish (8) and TPL2-deficient mice in that TNFα production by juicy macrophages is abnormal in response to TLR agonists. In TPL2-deficient macrophages, the levels of TNF-α are normal, but the transport of TNF-α mRNA to the cytoplasm in response to LPS is defective, suggesting that TPL2 regulates TNF-α mRNA transport, but not stability (6).

Primers PCR Primer
juicy(F):5'- TGTTCTGGTGACAACGATCATCCAATG -3'
juicy(R):5'- GAAGCCAAAACCGTGAGCTTTCC -3'

Sequencing Primer
juicy_seq(F):5'- AATGTTGCCATTTTGTCCCC -3'
juicy_seq(R):5'- ACACTAGGTGGGTTCCTGAC -3'
Genotyping

Juicy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Juicy(F): 5’- TGTTCTGGTGACAACGATCATCCAATG-3’

Juicy(R): 5’- GAAGCCAAAACCGTGAGCTTTCC-3’

 

Sequencing Primer

Juicy_seq(F): 5’- AATGTTGCCATTTTGTCCCC-3’
 

Juicy_seq(R): 5’- ACACTAGGTGGGTTCCTGAC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 664 nucleotides is amplified (Chr.18: 4339397-4339843, GRCm38; NC_000084):

 

tgttctggtg acaacgatca tccaatgttg ccattttgtc cccttcattg ctgattgtca       

cagcatttcc agaccatcac caatacaatc aatcaattac ctctgttccc cggaggtcct      

tgggaagata gacatcttca gtcatcttaa cactcaggcc aaaatctacc aaaacagctt      

ttgtagacat gaatacaatg ttgctagctg caacgagagg ggtttttaat gtgagttaat      

gcatcctaac ccaacaggaa aatcatctag aacagcaagt tccaagcaga gcagaaggaa      

acgcttctga taatgactca ggtggttcac cccagaagag agaagtaggg gagcagtcag      

gtgaaaacac ctgaggcctg tcaggaaccc acctagtgtg ggcagctagg agctacagcc      

agcaggaaag ctcacggttt tggcttc

 

FASTA sequence

 

Chr. + strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, T>G; sense strand, A>C).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsYing Wang, Hexin Shi and Bruce Beutler