Phenotypic Mutation 'business_class' (pdf version)
Allele | business_class |
Mutation Type |
missense
|
Chromosome | 4 |
Coordinate | 101,622,069 bp (GRCm39) |
Base Change | T ⇒ A (forward strand) |
Gene |
Lepr
|
Gene Name | leptin receptor |
Synonym(s) | leptin receptor gene-related protein, obl, Obr, Leprb, obese-like, Modb1, LEPROT, OB-RGRP |
Chromosomal Location |
101,574,601-101,672,549 bp (+) (GRCm39)
|
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010] PHENOTYPE: Homozygous mutants are hyperphagic, low-activity, poorly cold-adapted, sterile and have enhanced fat conversion. They are obese, hyperinsulinemic and, on certain strains, severely hyperglycemic. Heterozygotes are normal but resistant to prolonged fasting. [provided by MGI curators]
|
Accession Number | NCBI RefSeq: NM_146146, NM_010704; MGI: 104993
|
Mapped | Yes |
Amino Acid Change |
Phenylalanine changed to Isoleucine
|
Institutional Source | Beutler Lab |
Gene Model |
not available |
AlphaFold |
P48356 |
SMART Domains |
Protein: ENSMUSP00000037385 Gene: ENSMUSG00000057722 AA Change: F334I
Domain | Start | End | E-Value | Type |
transmembrane domain
|
7 |
29 |
N/A |
INTRINSIC |
FN3
|
236 |
315 |
1.5e-5 |
SMART |
Pfam:Lep_receptor_Ig
|
328 |
418 |
6.3e-23 |
PFAM |
FN3
|
535 |
618 |
4.93e-1 |
SMART |
FN3
|
641 |
721 |
3.25e1 |
SMART |
FN3
|
736 |
818 |
2.35e0 |
SMART |
transmembrane domain
|
838 |
860 |
N/A |
INTRINSIC |
low complexity region
|
908 |
921 |
N/A |
INTRINSIC |
low complexity region
|
1050 |
1065 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000037552)
|
SMART Domains |
Protein: ENSMUSP00000099838 Gene: ENSMUSG00000057722 AA Change: F334I
Domain | Start | End | E-Value | Type |
transmembrane domain
|
7 |
29 |
N/A |
INTRINSIC |
FN3
|
236 |
315 |
1.5e-5 |
SMART |
Pfam:Lep_receptor_Ig
|
329 |
420 |
2.6e-29 |
PFAM |
FN3
|
535 |
618 |
4.93e-1 |
SMART |
FN3
|
641 |
721 |
3.25e1 |
SMART |
FN3
|
736 |
818 |
2.35e0 |
SMART |
transmembrane domain
|
838 |
860 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000102777)
|
SMART Domains |
Protein: ENSMUSP00000102534 Gene: ENSMUSG00000057722 AA Change: F334I
Domain | Start | End | E-Value | Type |
transmembrane domain
|
7 |
29 |
N/A |
INTRINSIC |
FN3
|
236 |
315 |
1.5e-5 |
SMART |
Pfam:Lep_receptor_Ig
|
329 |
420 |
2.6e-29 |
PFAM |
FN3
|
535 |
618 |
4.93e-1 |
SMART |
FN3
|
641 |
721 |
3.25e1 |
SMART |
FN3
|
736 |
818 |
2.35e0 |
SMART |
transmembrane domain
|
838 |
860 |
N/A |
INTRINSIC |
|
Predicted Effect |
probably damaging
PolyPhen 2
Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000106921)
|
Meta Mutation Damage Score |
Not available |
Is this an essential gene? |
Non Essential (E-score: 0.000) |
Phenotypic Category |
Autosomal Semidominant |
Candidate Explorer Status |
loading ... |
Single pedigree Linkage Analysis Data
|
|
Penetrance | 100% |
Alleles Listed at MGI | All alleles( 36) : Targeted, knock-out( 3) Targeted, other( 12) Transgenic( 1) Spontaneous( 13) Chemically induced( 7)
|
Lab Alleles |
Allele | Source | Chr | Coord | Type | Predicted Effect | PPH Score |
IGL00089:Lepr
|
APN |
4 |
101672232 |
missense |
probably benign |
|
IGL01111:Lepr
|
APN |
4 |
101671852 |
missense |
possibly damaging |
0.77 |
IGL01324:Lepr
|
APN |
4 |
101625265 |
missense |
probably benign |
0.23 |
IGL01372:Lepr
|
APN |
4 |
101592774 |
missense |
possibly damaging |
0.67 |
IGL01626:Lepr
|
APN |
4 |
101590731 |
missense |
probably benign |
0.10 |
IGL01733:Lepr
|
APN |
4 |
101622279 |
missense |
probably benign |
0.00 |
IGL01815:Lepr
|
APN |
4 |
101671987 |
missense |
possibly damaging |
0.49 |
IGL01899:Lepr
|
APN |
4 |
101637184 |
missense |
possibly damaging |
0.86 |
IGL02138:Lepr
|
APN |
4 |
101625264 |
missense |
probably damaging |
0.98 |
IGL02161:Lepr
|
APN |
4 |
101602875 |
missense |
probably damaging |
0.97 |
IGL02653:Lepr
|
APN |
4 |
101622141 |
missense |
probably benign |
0.44 |
IGL02735:Lepr
|
APN |
4 |
101639835 |
missense |
probably damaging |
1.00 |
IGL03035:Lepr
|
APN |
4 |
101622177 |
missense |
probably damaging |
1.00 |
IGL03083:Lepr
|
APN |
4 |
101671876 |
nonsense |
probably null |
|
IGL03160:Lepr
|
APN |
4 |
101622103 |
missense |
probably damaging |
1.00 |
aufsetzigen
|
UTSW |
4 |
101609372 |
missense |
probably damaging |
1.00 |
beastly
|
UTSW |
4 |
101671788 |
missense |
probably benign |
|
cherub
|
UTSW |
4 |
101625259 |
missense |
probably benign |
0.25 |
clodhopper
|
UTSW |
4 |
101622487 |
splice site |
probably null |
|
donner
|
UTSW |
4 |
101672398 |
missense |
probably damaging |
1.00 |
fluffy
|
UTSW |
4 |
101649220 |
missense |
probably damaging |
1.00 |
giant
|
UTSW |
4 |
101622349 |
critical splice donor site |
probably null |
|
gordo
|
UTSW |
4 |
101622502 |
missense |
probably damaging |
0.97 |
Immunoglutton
|
UTSW |
4 |
101622498 |
splice site |
probably benign |
|
Jumbo_shrimp
|
UTSW |
4 |
101622151 |
nonsense |
probably null |
|
lowleaning
|
UTSW |
4 |
101671588 |
splice site |
probably null |
|
odd
|
UTSW |
4 |
101585271 |
splice site |
probably benign |
|
paleo
|
UTSW |
4 |
101602842 |
missense |
possibly damaging |
0.94 |
R0140_Lepr_245
|
UTSW |
4 |
101625264 |
missense |
probably damaging |
1.00 |
well-upholstered
|
UTSW |
4 |
101630155 |
synonymous |
probably benign |
|
worldly
|
UTSW |
4 |
101625425 |
missense |
possibly damaging |
0.96 |
PIT4651001:Lepr
|
UTSW |
4 |
101649194 |
missense |
probably damaging |
1.00 |
PIT4696001:Lepr
|
UTSW |
4 |
101637180 |
missense |
probably benign |
0.10 |
R0140:Lepr
|
UTSW |
4 |
101625264 |
missense |
probably damaging |
1.00 |
R0197:Lepr
|
UTSW |
4 |
101609349 |
missense |
possibly damaging |
0.64 |
R0279:Lepr
|
UTSW |
4 |
101607541 |
missense |
probably benign |
0.05 |
R0487:Lepr
|
UTSW |
4 |
101625290 |
nonsense |
probably null |
|
R0498:Lepr
|
UTSW |
4 |
101602889 |
missense |
probably benign |
0.01 |
R0506:Lepr
|
UTSW |
4 |
101630207 |
splice site |
probably benign |
|
R0512:Lepr
|
UTSW |
4 |
101671901 |
missense |
possibly damaging |
0.87 |
R0512:Lepr
|
UTSW |
4 |
101649216 |
missense |
probably damaging |
1.00 |
R0726:Lepr
|
UTSW |
4 |
101622131 |
missense |
probably benign |
0.01 |
R1054:Lepr
|
UTSW |
4 |
101639793 |
missense |
probably damaging |
0.97 |
R1109:Lepr
|
UTSW |
4 |
101628552 |
missense |
probably damaging |
1.00 |
R1398:Lepr
|
UTSW |
4 |
101649216 |
missense |
probably damaging |
1.00 |
R1464:Lepr
|
UTSW |
4 |
101592878 |
missense |
probably benign |
0.08 |
R1464:Lepr
|
UTSW |
4 |
101592878 |
missense |
probably benign |
0.08 |
R1519:Lepr
|
UTSW |
4 |
101646541 |
missense |
probably damaging |
0.97 |
R1602:Lepr
|
UTSW |
4 |
101602842 |
missense |
possibly damaging |
0.94 |
R1830:Lepr
|
UTSW |
4 |
101592874 |
missense |
probably damaging |
1.00 |
R1850:Lepr
|
UTSW |
4 |
101590620 |
missense |
possibly damaging |
0.67 |
R1918:Lepr
|
UTSW |
4 |
101630033 |
missense |
probably benign |
0.08 |
R1928:Lepr
|
UTSW |
4 |
101639927 |
splice site |
probably benign |
|
R2099:Lepr
|
UTSW |
4 |
101630185 |
missense |
probably damaging |
1.00 |
R2102:Lepr
|
UTSW |
4 |
101630178 |
missense |
possibly damaging |
0.95 |
R2175:Lepr
|
UTSW |
4 |
101622576 |
missense |
probably benign |
0.01 |
R2254:Lepr
|
UTSW |
4 |
101672309 |
missense |
probably benign |
0.26 |
R2396:Lepr
|
UTSW |
4 |
101590725 |
missense |
probably benign |
0.19 |
R2508:Lepr
|
UTSW |
4 |
101648093 |
missense |
probably damaging |
0.98 |
R2571:Lepr
|
UTSW |
4 |
101625369 |
missense |
possibly damaging |
0.96 |
R3790:Lepr
|
UTSW |
4 |
101648111 |
splice site |
probably benign |
|
R3882:Lepr
|
UTSW |
4 |
101672462 |
missense |
probably damaging |
1.00 |
R3933:Lepr
|
UTSW |
4 |
101622498 |
splice site |
probably benign |
|
R4211:Lepr
|
UTSW |
4 |
101590611 |
missense |
probably benign |
0.19 |
R4343:Lepr
|
UTSW |
4 |
101622349 |
critical splice donor site |
probably null |
|
R4345:Lepr
|
UTSW |
4 |
101622349 |
critical splice donor site |
probably null |
|
R4544:Lepr
|
UTSW |
4 |
101625425 |
missense |
possibly damaging |
0.96 |
R4546:Lepr
|
UTSW |
4 |
101671838 |
missense |
probably benign |
0.35 |
R4724:Lepr
|
UTSW |
4 |
101622562 |
nonsense |
probably null |
|
R4797:Lepr
|
UTSW |
4 |
101637244 |
missense |
possibly damaging |
0.90 |
R4860:Lepr
|
UTSW |
4 |
101646534 |
missense |
probably benign |
0.14 |
R4860:Lepr
|
UTSW |
4 |
101646534 |
missense |
probably benign |
0.14 |
R4929:Lepr
|
UTSW |
4 |
101672314 |
missense |
probably benign |
0.00 |
R4939:Lepr
|
UTSW |
4 |
101590635 |
missense |
possibly damaging |
0.78 |
R5377:Lepr
|
UTSW |
4 |
101672216 |
missense |
possibly damaging |
0.71 |
R5520:Lepr
|
UTSW |
4 |
101602734 |
missense |
probably benign |
0.00 |
R5966:Lepr
|
UTSW |
4 |
101649324 |
intron |
probably benign |
|
R6092:Lepr
|
UTSW |
4 |
101649220 |
missense |
probably damaging |
1.00 |
R6130:Lepr
|
UTSW |
4 |
101622569 |
missense |
probably damaging |
0.99 |
R6168:Lepr
|
UTSW |
4 |
101592789 |
missense |
probably damaging |
0.99 |
R6232:Lepr
|
UTSW |
4 |
101671588 |
splice site |
probably null |
|
R6380:Lepr
|
UTSW |
4 |
101622151 |
nonsense |
probably null |
|
R6427:Lepr
|
UTSW |
4 |
101631454 |
missense |
possibly damaging |
0.47 |
R6428:Lepr
|
UTSW |
4 |
101637295 |
missense |
probably damaging |
1.00 |
R6641:Lepr
|
UTSW |
4 |
101622502 |
missense |
probably damaging |
0.97 |
R6650:Lepr
|
UTSW |
4 |
101672398 |
missense |
probably damaging |
1.00 |
R6859:Lepr
|
UTSW |
4 |
101622487 |
splice site |
probably null |
|
R7023:Lepr
|
UTSW |
4 |
101646484 |
missense |
probably damaging |
1.00 |
R7145:Lepr
|
UTSW |
4 |
101609394 |
missense |
probably benign |
0.00 |
R7174:Lepr
|
UTSW |
4 |
101607535 |
missense |
probably benign |
0.01 |
R7179:Lepr
|
UTSW |
4 |
101602856 |
missense |
probably benign |
0.06 |
R7189:Lepr
|
UTSW |
4 |
101671961 |
missense |
probably benign |
0.00 |
R7426:Lepr
|
UTSW |
4 |
101602853 |
missense |
probably benign |
0.03 |
R7531:Lepr
|
UTSW |
4 |
101609372 |
missense |
probably damaging |
1.00 |
R7620:Lepr
|
UTSW |
4 |
101609270 |
missense |
probably benign |
0.41 |
R7804:Lepr
|
UTSW |
4 |
101639783 |
missense |
probably damaging |
1.00 |
R8022:Lepr
|
UTSW |
4 |
101639754 |
missense |
probably benign |
0.32 |
R8142:Lepr
|
UTSW |
4 |
101622616 |
missense |
possibly damaging |
0.93 |
R8227:Lepr
|
UTSW |
4 |
101628559 |
missense |
probably damaging |
0.99 |
R8426:Lepr
|
UTSW |
4 |
101671841 |
missense |
probably benign |
0.12 |
R8447:Lepr
|
UTSW |
4 |
101671688 |
missense |
probably benign |
0.08 |
R8531:Lepr
|
UTSW |
4 |
101622612 |
missense |
probably damaging |
1.00 |
R8682:Lepr
|
UTSW |
4 |
101649269 |
missense |
probably benign |
0.00 |
R8897:Lepr
|
UTSW |
4 |
101649233 |
missense |
probably damaging |
0.98 |
R9096:Lepr
|
UTSW |
4 |
101631418 |
missense |
possibly damaging |
0.95 |
R9177:Lepr
|
UTSW |
4 |
101602798 |
nonsense |
probably null |
|
R9241:Lepr
|
UTSW |
4 |
101671788 |
missense |
probably benign |
|
R9604:Lepr
|
UTSW |
4 |
101590473 |
missense |
probably benign |
0.01 |
R9711:Lepr
|
UTSW |
4 |
101592851 |
nonsense |
probably null |
|
X0026:Lepr
|
UTSW |
4 |
101590524 |
missense |
possibly damaging |
0.47 |
Z1176:Lepr
|
UTSW |
4 |
101602811 |
missense |
probably damaging |
0.99 |
Z1177:Lepr
|
UTSW |
4 |
101592792 |
missense |
probably damaging |
1.00 |
|
Mode of Inheritance |
Autosomal Semidominant |
Local Stock | Embryos |
MMRRC Submission |
016986-UCD
|
Last Updated |
2019-03-30 7:46 AM
by Diantha La Vine
|
Record Created |
unknown
|
Record Posted |
2008-04-22 |
Phenotypic Description |
The Business class mutation was identified in ENU-mutagenized G3 mice, and is characterized by massive obesity, diabetes, and low fertility in homozygous animals ( 1) (Figure 1). The mutation is semidominant, with heterozygous animals exhibiting increased mass relative to wildtype animals. This phenotype has not been quantified. The usually sterile homozygotes are propagated from heterozygous stock. Because of the similarity between these animals and the phenotype of mice with leptin or leptin receptor mutations ( 2-4), direct sequencing was performed and a mutation in the leptin receptor ( Lepr) gene was found. Business class mutants have similar phenotypes to allelic Cherub, Well-upholstered and odd mutants.
Extensive phenotypic charactization of homozygous business class mice revealed hyperphagia, significantly elevated circulating levels of leptin, insulin, and the pro-inflammatory cytokine interleukin 6 (IL-6) relative to wild type animals. In addition, they display decreased insulin sensitivity, impaired glucose tolerance, as well as lower core body temperature, locomotor activity, and other metabolic parameters ( 1).
|
Nature of Mutation | The Business class mutation corresponds to a T to A transversion at position 999 of the Lepr transcript (record for variant 1; NM_146146), in exon 7 of 18 total exons.
982 ACACAAGATGTTGTGTATTTTCCACCCAAAATT
328 -T--Q--D--V--V--Y--F--P--P--K--I-
The mutated nucleotide is indicated in red lettering and results in the conversion of tyrosine 333 to a stop codon. This removes the C-terminal 829 amino acids of the leptin receptor (LEPR) protein.
|
Illustration of Mutations in
Gene & Protein |
|
---|
Protein Prediction | The Lepr or obr gene encodes an 1162 amino acid protein that is the receptor for leptin, a four-helical cytokine-like hormone produced primarily by adipocytes ( 2;5). Mouse LEPR, or OB-R (for obesity receptor), is 75% identical to human LEPR ( 3;6). The leptin receptor is a member of the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT (signal transducer and activator of transcription) proteins. These receptors include the interleukin-6 (IL-6) receptor, the granulocyte colony-stimulating factor (G-CSF) receptor, and the leukemia inhibitory factor (LIF) receptor ( 3;7).
At least six isoforms of the leptin receptor, designated OB-Ra-OB-Rf, are generated from the Lepr gene through alternative splicing ( 6;8;9) (Figure 2). With the exception of a soluble isoform (OB-Re), all are single-pass membrane-spanning proteins differing only in the sequences of their C-terminal intracellular domains ( 6;8-10). Intracellularly, the membrane-spanning leptin receptor isoforms contain a highly conserved proline-rich box 1 (intracellular amino acid 6-17 for the human receptors) ( 11;12), which may have some signaling function in vitro ( 13). However, only the longest isoform, OB-Rb, has a 302 amino acid intracellular domain containing all the functional domains required to modulate the known intracellular signaling effectors of leptin (see Background) ( 7;14).
The extracellular portion of the human leptin receptor contains at least seven structural domains that are similar to domains contained in related cytokine receptors ( 15-17). Domains 1 (amino acids 62-178), and 4 (amino acids 428-535) are CK domains named for their conserved cysteine-containing motifs. Domains 2 (amino acids 235-327), 5 (amino acids 536-635), 6 (amino acids 636-731), and 7 (amino acids 732-841) each possess a fibronectin type III fold. Domain 3 (amino acids 328-427) has an Ig-like fold. Domains 1 and 2 form the cytokine receptor homology module 1, while domains 4 and 5 form the cytokine receptor homology module 2. These modules each contain a cytokine-like binding motif, Trp-Ser-Xaa-Trp-Ser ( 3;15). The fibronectin type III domains are predicted to be composed of β-strands that form anti-parallel β-sandwiches ( 17). Despite the structural prediction that LEPR might have two ligand-binding sites, its sole leptin binding domain is in the second cytokine receptor homology module spanning residues 428-635. The purified leptin-binding subdomain forms a stable 1:1 complex with leptin, although other reports suggest the leptin/leptin receptor complex exists in a 2:4 stoichiometry with two leptin receptor proteins required to bind one leptin molecule ( 16;18;19). Using the GCSF/GCSFR 2:2 crystal structure as a model, the binding of leptin to the receptor reveals two interaction interfaces. The major interface consists largely of hydrophobic and polar interactions. The minor interface also has a number of hydrophobic interactions, but uses main-chain hydrogen bonding as well ( 19;20). Alternatively, a structural model of a 2:4 leptin/leptin receptor complex based on the crystal structure of IL-6/IL-6Ra/gp130 complex reveals three binding sites (I, II, III) on leptin. Binding site I appears at the C-terminal region of helix D of the leptin molecule, binding site II is composed of residues at the surface of helices A and C, and binding site III is close to the N-terminal region of helix D ( 16).
The Business class mutation results in protein truncation at amino acid 333. This deletes most of the protein including the long C-terminal domain important for intracellular signaling, the membrane spanning region, and much of the extracellular region including the ligand-binding region.
|
Expression/Localization | The short receptor isoforms of the leptin receptors are generally the most abundant forms in most tissues, except the hypothalamus ( 3;21). In the hypothalamus, the most abundant leptin receptor is OB-Rb, which is expressed in areas important for regulation of energy balance such as arcuate (ARC), paraventricular (PVN), dorsomedial (DMN), and ventromedial (VMH) nuclei ( 22-25). Expression of Ob-Rb also occurs in other brain regions such as the hippocampus, cerebral cortex, and the choroid plexus from which the leptin receptor was cloned ( 3;23-26). The OB-Rb receptor is also found in lungs, kidneys, liver, pancreatic β-cells, thyroid gland, anterior pituitary, placenta, adrenal glands, gonads, and vasculature ( 21;27-35). Finally, OB-Rb is expressed on the surface of immune system cells involved in innate and adaptive immunity including dendritic cells (DC), T lymphocytes, NK cells, as well as hematopoietic stem cells and B cell progenitors ( 35-37).
During development, expression of leptin receptor isoforms is highly dynamic and varies from species to species. In rat brains at embryonic day (E) 14, cells immunoreactive for OB-Rb are observed in the ventricular layer containing immature neuronal cells. At 18 days of gestation, low levels of staining occurred in the paraventricular nucleus (PVN), and ependymal cells. At birth, the immunoreactivity of OB-Rb in the PVN appears to be much lower than that in adult rats, and remained low during the suckling period ( 38). In addition, rat neonatal pituitary gland expresses leptin receptors at levels far in excess of those observed in mature rats ( 39). In the mouse, Ob-Rb mRNA was detected in the brain by RT-PCR at E10.5. Using in situ hybridization, Ob-Rb mRNA was observed in the ventricular zone of the rhombencephalon at E11.5. At E12.5, it was also expressed in the ventricular zone of the telencephalon, mesencephalon, and cerebellar primordium. From E14.5, it was expressed in the cortical plate of the telencephalon, and the ventricular zone of the thalamus. At E16.5, Ob-Rb was expressed in the premamillary hypothalamic nucleus, superficial gray matter of the superior colliculus, external germinal and Purkinje cell layers of the cerebellum, and facial nucleus. At E18.5, it was expressed in the arcuate nucleus and ventromedial hypothalamic nucleus, similar to the adult ( 40). In peripheral embryonic mouse tissues, an in situ hybridization probe recognizing all Lepr isoforms was found in developing bone, mesenchyme, notochord, liver, as well as epithelial structures ( 27;41). Lepr mRNA was detected at higher levels in peripheral tissues of newborn mice than in adult mice ( 42).
|
Background | Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation [reviewed in ( 19;34;36)]. It is primarily produced by adipocytes in proportion to fat stores, but can also be produced by placenta (syncytiotrophoblasts), ovaries, skeletal muscle, stomach, mammary epithelial cells, bone marrow, pituitary and liver ( 43). Leptin exerts its action on the body by binding to the long form of the leptin receptor, OB-Rb, and initiating various signal transduction pathways ( 6-9;13). Several putative functions for the short leptin receptor isoforms have been hypothesized. Some evidence suggests that OB-Ra is responsible for the transport of leptin across the blood-brain barrier ( 11), whereas the soluble OB-Re binds and stabilizes circulating leptin ( 44;45). The major functions of all short isoforms, except OB-Re, appear to be limited to leptin transport, internalization and degradation ( 46). In vitro evidence suggests that they are capable of triggering certain signaling events, as they all contain a highly conserved proline-rich box region that recruits and binds Janus kinases (JAKs) ( 11-13). Since only the long receptor isoform, OB-Rb, contains the full intracellular signaling sequence, it is the only receptor isoform mediating leptin signaling in vivo ( 6-9;13;47).
Upon leptin binding to OB-Rb, activation of JAK2 at the OB-R box 1 motif is activated ( 11;14) (Figure 3). JAK2 auto-phosphorylates itself, as well as specific tyrosine residues on the intracellular domain of OB-Rb (Tyr974, Tyr985, Tyr1077 and Tyr1138) to provide docking sites for signaling proteins containing Src homology 2 (SH2) domains. Each phosphorylated tyrosine residue then recruits and activates a distinct set of downstream signaling proteins. The phosphorylated tyrosine residues Tyr1077 and Tyr1138 bind and activate signal transducer and activator of transcription (STAT) proteins. Both Tyr1077 and Tyr1138 bind to STAT5, while only Tyr1138 recruits STAT1 and STAT3 ( 36;48). The other two phosphorylated residues Tyr974 and Tyr985 recruit SH2 domain-containing phosphatase 2 (SHP2). SHP2 then activates the mitogen-activated protein kinase (MAPK) pathways including extracellular signal-regulated kinase (ERK1/2), p38, MAPK and p42/44 MAPK pathways through interaction with the adaptor protein growth factor receptor-bound protein 2 (GRB2) ( 48-50). The auto-phosphorylated JAK2 at the box 1 motif can phosphorylate insulin receptor substrate1/2 (IRS1/2) that leads to activation of phosphatidylinositol 3-kinase (PI3K)/Akt and the MAPK pathways. OB-Rb has also been reported to signal via the AMP-activated protein kinase (AMPK) pathway ( 10;49-51). OB-Rb activation induces transcription of the specific suppressor of SOCS3 in the hypothalamic area by direct binding of STAT3 to its response element ( 49;52). SOCS3 is an SH2 domain-containing protein that can bind phosphorylated Tyr985 on OB-Rb and other sites on JAK2 to inhibit leptin receptor signaling. This negative feedback loop via SOCS3 is speculated to be central to the development of leptin resistance that occurs in many obese subjects due to the high circulating levels of leptin caused by increased fat stores ( 52;53).
In the hypothalamus, leptin binding to OB-Rb on the appropriate neurons, including the ARC and VMH nuclei, causes diminished feeding activity, and accelerated basal metabolic rate by regulating numerous neuropeptides involved in feeding. Two sets of neurons act as sensors of whole-body energy status, and intiate signals to maintain energy stores at a constant level (Figure 4). The AgRP/NPY neurons (producing agouti- related peptide and neuro peptide Y) are inhibited by leptin, while POMC/CART neurons (producing pro- oprio melano cortin, its proteolytic products, and cocaine- amphetamine- regulated transcript) are stimulated by leptin. Both AgRP/NPY and POMC/CART neurons synapse onto neurons expressing melanocortin receptors 3 and 4 (MC3R, MC4R). POMC is the precursor of various peptides that activate MC3R and MC4R. When leptin levels are low, AgRP/NPY neurons are activated and POMC/CART neurons are inhibited, producing AgRP but not POMC. Consequently, melanocortin receptors are inhibited and food intake increases ( 54-57). The melanocortin receptors are critical in maintaining body weight regulation. Mutations in both MCR3 and MCR4 (mutated in Southbeach) cause obesity in humans and animals, and MCR4 mutations are a common cause of obesity in humans ( 58-60).
Other CNS functions of leptin include direct leptin signaling in areas of the brain regulating motivation to feed, and indirect regulation of gonadotropin-releasing hormone (GnRH) neurons of the neuroendocrine reproductive axis, and of the activity of the sympathetic nervous system. Leptin also regulates the hypothalamic-pituitary-adrenal (HPA) axis by affecting hypothalamic corticotropin-releasing hormone (CRH) neurons, which subsequently modulate the release of glucocorticoids from the adrenal cortex ( 34;55). Leptin also regulates the expression of genes important for thermogenesis, such as thyrotropin-releasing hormone (TRH). A subgroup of TRH neurons in the paraventricular nucleus is activated directly by leptin through STAT3 binding to a response element in the TRH promoter ( 61;62). TRH is essential for pituitary gland production of thyroid-stimulating hormone, as well as thyroid gland synthesis of thyroid hormone. Thyroid hormone is well recognized as a stimulator of energy expenditure through increasing basal metabolic rate ( 33). Finally, leptin signaling in the brain appears to have important anti-apoptotic effects ( 63). Indeed, many of the signaling pathways activated by leptin through the leptin receptor are anti-apoptotic and growth-promoting, and leptin signaling has been shown to promote survival and growth in many cell types including cells of the immune system ( 35;63).
Leptin also plays a role in inflammatory and immune responses. Behaving as a cytokine and activating JAK/STAT signaling in immune cells, leptin has been shown to provide a proliferative signal in hematopoiesis and lymphopoiesis, and appears to have an effect on the differentiation and survival of many types of immune cells including thymocytes (T cells), natural killer (NK) cells, and dendritic cells (DC) ( 30;35;36;64). Leptin activates monocytes, DC and macrophages, and stimulates them to produce Th1-type cytokines ( 30;64). Leptin can also activate neutrophils, and NK cells. By activating STAT3, leptin upregulates the expression of genes encoding perforin and IL-2, which are necessary for NK function ( 37). Importantly, leptin has been shown to modulate adaptive immunity by enhancing T-cell survival and stimulating their production of pro-inflammatory cytokines such as IFN-γ and IL-2 ( 35). Recent evidence demonstrates a detrimental involvement of leptin in promoting the pathogenesis of various autoimmune diseases such as rheumatoid arthritis, colitis, multiple sclerosis and Type 1 diabetes, consistent with its role as a pro-inflammatory cytokine ( 36). Despite evidence suggesting that leptin and its receptor can have a direct role in immune system modulation ( 36), other work suggests that the primary effects of leptin on immunity and inflammation are secondary to its effects on the CNS. Through the use of bone marrow chimaeras and thymus transplantation experiments, expression of the leptin receptor on either bone marrow-derived cells or thymic epithelial cells was shown to be unnecessary for normal T-cell development ( 65). Moreover, in contrast to its direct pro-inflammatory role in the immune system, leptin has an anti-inflammatory effect during systemic inflammation through activation of the HPA axis and modulating glucocorticoids ( 53).
Humans and other animals deficient for leptin or its receptor, exhibit hyperphagia and low metabolism that results in obesity and insulin resistance ( 2;6;66). They also display characteristics similar to the starvation response despite their obesity, including hypothyroidism, infertility, decreased growth, cold intolerance, and decreased immune function ( 2;3;66). Several rat and mouse leptin receptor mutants exist, including the classic db/db mouse mutant, which is defective for the long form of LEPR ( 8;9;67). Db/db mutants have highly similar phenotypes from mutants null for the leptin receptor ( db3j/ db3j), suggesting that the short forms of the leptin receptor play only minor roles in vivo ( 47;67). In addition to the classical leptin receptor mutants, several transgenic, tissue-specific knockout, and knock-in leptin receptor mice have been generated to examine the role of leptin and leptin signaling in vivo. By using tissue-specific knockout mice and transgenic overexpression of ObRb in the brain to rescue leptin receptor mutant mice, the role of leptin signaling in the CNS versus peripheral tissues has been examined ( 47;67-71). Although it is clear that leptin signaling in peripheral tissues can have an effect on whole-body metabolism, leptin signaling in CNS neurons plays a far more important role in energy balance and homeostasis. Transgenic expression of the leptin receptor in the brain is sufficient to reverse the obesity, diabetes, and infertility of db/db mice ( 69). Finally, mice that express only OB-Rb mutated at specific tyrosine residues exhibit different phenotypes, suggesting specific roles of the various leptin receptor signal transduction pathways. Knock-in mice expressing a leptin receptor mutated at Tyr1138, which signals through STAT3, are hyperphagic and obese, but have normal fertility and immune function ( 72;73). Mice expressing a leptin receptor mutant for Tyr985 are lean, consistent with the binding of the negative regulator SOCS3 to this site to downregulate leptin signaling ( 74).
The phenotypes of a number of knockout animal models have also given insights into the roles of various leptin receptor signal transduction pathways. STAT1-deficient mice (see domino and poison) are not obese, but they do have increased bone mass as do LEPR mutants, although these phenotypes may occur through different mechanisms ( 75;76). STAT3 knockout animals are embryonic lethal, but neuronal-specific knockouts are hyperphagic, obese, diabetic, and infertile ( 77). Similarly, neuronal-specific knockouts of SH2-B, a JAK-interacting protein, and SHP2 are also obese ( 78;79). STAT5 knockout mice reveal roles for STAT5 in mammary development, fertility, and sexually dimorphic growth hormone effects, which may be partially due to a role in leptin receptor signaling ( 80).
Mutations affecting the leptin receptor are not a major cause of human obesity, and only a small number of patients show destructive mutations at the LEPR locus ( 66) (OMIM #601665 *601007). LEPR polymorphisms have been found to be associated with human obesity and impaired glucose homeostasis, but make a minor contribution to these phenotypes as a whole, consistent with etiologic complexity of both phenotypes in humans ( 81;82).
|
Putative Mechanism | The Business class mutation results in early truncation of the leptin receptor. As the mutant protein is missing most of the leptin receptor functional domains including the ligand-binding region, it is not expected to have any function, and should behave like the db3j mice, which are null for all known leptin receptor isoforms ( 67). Indeed the phenotypes seen in Business class homozygotes are highly similar to the phenotypes seen in both homozygous db and db3j mutant mice ( 6;67). However, business class homozygous animals display a subtle trend toward higher body weight and insulin levels, lower oxygen, carbon dioxide production, respiratory exchange ratio (RER), and temperature than db/db mice suggesting that the short isoforms of the leptin receptor may play additional roles in energy homeostasis ( 1). Business class mutants also have phenotypes similar to Cherub and Well-upholstered animals. Both of these mutations result in truncation of LEPR in the CRH2 domain (Figure 2).
|
Primers |
Primers cannot be located by automatic search.
|
Genotyping | Business class genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
Primers
Bus(F): 5’- GCTGGAAGCCTGTCGTACTCTTCAC -3’
Bus(R): 5’- TACACTGCGTCATAGGTAAACTTCCCTC -3’
PCR program
1) 94°C 1:00
2) 94°C 0:30
3) 58°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 35X
6) 72°C 5:00
7) 4°C ∞
The following sequence of 456 nucleotides (from Genbank genomic region NC_000070 for linear genomic sequence of Lepr) is amplified:
47204 gctggaa gcctgtcgta
47221 ctcttcacgg aggctctgtt catttgggag caggggttcc tgccactcta aagggctgtc
47281 cacagcagca gcaaggttct cagtgcacgc atttgatttt ggcagggtaa ccaggacgtg
47341 gcaatctctt tcttgcggta agactgctca gatgatggtt tctctttcct tctaaactcc
47401 caccttcctt tctctgttac agatgttgtg tattttccac ccaaaattct gactagtgtt
47461 ggatcgaatg cttcttttca ttgcatctac aaaaacgaaa accagattat ctcctcaaaa
47521 cagatagttt ggtggaggaa tctagctgag aaaatccctg agatacagta cagcattgtg
47581 agtgaccgag ttagcaaagt taccttctcc aacctgaaag ccaccagacc tcgagggaag
47641 tttacctatg acgcagtgta
Primer binding sites are underlined; the mutated T is highlighted in red.
|
References | 1. Osborn, O., Sanchez-Alavez, M., Brownell, S. E., Ross, B., Klaus, J., Dubins, J., Beutler, B., Conti, B., and Bartfai, T. Metabolic Characterization of a Mouse Deficient in All Known Leptin Receptor Isoforms. (2009) Cell.Mol.Neurobiol. epub.
2. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J. M. (1994) Positional cloning of the mouse obese gene and its human homologue, Nature 372, 425-432.
3. Tartaglia, L. A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G. J., Campfield, L. A., Clark, F. T., Deeds, J., Muir, C., Sanker, S., Moriarty, A., Moore, K. J., Smutko, J. S., Mays, G. G., Wool, E. A., Monroe, C. A., and Tepper, R. I. (1995) Identification and expression cloning of a leptin receptor, OB-R, Cell 83, 1263-1271.
4. Chung, W. K., Belfi, K., Chua, M., Wiley, J., Mackintosh, R., Nicolson, M., Boozer, C. N., and Leibel, R. L. (1998) Heterozygosity for Lep(ob) or Lep(rdb) affects body composition and leptin homeostasis in adult mice, Am. J Physiol 274, R985-R990.
5. Zhang, F., Basinski, M. B., Beals, J. M., Briggs, S. L., Churgay, L. M., Clawson, D. K., DiMarchi, R. D., Furman, T. C., Hale, J. E., Hsiung, H. M., Schoner, B. E., Smith, D. P., Zhang, X. Y., Wery, J. P., and Schevitz, R. W. (1997) Crystal structure of the obese protein leptin-E100, Nature 387, 206-209.
6. Chen, H., Charlat, O., Tartaglia, L. A., Woolf, E. A., Weng, X., Ellis, S. J., Lakey, N. D., Culpepper, J., Moore, K. J., Breitbart, R. E., Duyk, G. M., Tepper, R. I., and Morgenstern, J. P. (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice, Cell 84, 491-495.
7. Baumann, H., Morella, K. K., White, D. W., Dembski, M., Bailon, P. S., Kim, H., Lai, C. F., and Tartaglia, L. A. (1996) The full-length leptin receptor has signaling capabilities of interleukin 6-type cytokine receptors, Proc. Natl. Acad. Sci. U. S. A 93, 8374-8378.
8. Lee, G. H., Proenca, R., Montez, J. M., Carroll, K. M., Darvishzadeh, J. G., Lee, J. I., and Friedman, J. M. (1996) Abnormal splicing of the leptin receptor in diabetic mice, Nature 379, 632-635.
9. Chua, S. C., Jr., Chung, W. K., Wu-Peng, X. S., Zhang, Y., Liu, S. M., Tartaglia, L., and Leibel, R. L. (1996) Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor, Science 271, 994-996.
12. White, D. W., Kuropatwinski, K. K., Devos, R., Baumann, H., and Tartaglia, L. A. (1997) Leptin receptor (OB-R) signaling. Cytoplasmic domain mutational analysis and evidence for receptor homo-oligomerization, J Biol. Chem. 272, 4065-4071.
13. Murakami, T., Yamashita, T., Iida, M., Kuwajima, M., and Shima, K. (1997) A short form of leptin receptor performs signal transduction, Biochem. Biophys. Res. Commun. 231, 26-29.
14. Kloek, C., Haq, A. K., Dunn, S. L., Lavery, H. J., Banks, A. S., and Myers, M. G., Jr. (2002) Regulation of Jak kinases by intracellular leptin receptor sequences, J Biol. Chem. 277, 41547-41555.
15. Fong, T. M., Huang, R. R., Tota, M. R., Mao, C., Smith, T., Varnerin, J., Karpitskiy, V. V., Krause, J. E., and Van Der Ploeg, L. H. (1998) Localization of leptin binding domain in the leptin receptor, Mol. Pharmacol. 53, 234-240.
16. Peelman, F., Couturier, C., Dam, J., Zabeau, L., Tavernier, J., and Jockers, R. (2006) Techniques: new pharmacological perspectives for the leptin receptor, Trends Pharmacol. Sci. 27, 218-225.
18. Sandowski, Y., Raver, N., Gussakovsky, E. E., Shochat, S., Dym, O., Livnah, O., Rubinstein, M., Krishna, R., and Gertler, A. (2002) Subcloning, expression, purification, and characterization of recombinant human leptin-binding domain, J Biol. Chem. 277, 46304-46309.
19. Zhang, F., Chen, Y., Heiman, M., and DiMarchi, R. (2005) Leptin: structure, function and biology, Vitam. Horm. 71, 345-372.
21. Lollmann, B., Gruninger, S., Stricker-Krongrad, A., and Chiesi, M. (1997) Detection and quantification of the leptin receptor splice variants Ob-Ra, b, and, e in different mouse tissues, Biochem. Biophys. Res. Commun. 238, 648-652.
22. Elmquist, J. K., Bjorbaek, C., Ahima, R. S., Flier, J. S., and Saper, C. B. (1998) Distributions of leptin receptor mRNA isoforms in the rat brain, J Comp Neurol. 395, 535-547.
23. Fei, H., Okano, H. J., Li, C., Lee, G. H., Zhao, C., Darnell, R., and Friedman, J. M. (1997) Anatomic localization of alternatively spliced leptin receptors (Ob-R) in mouse brain and other tissues, Proc. Natl. Acad. Sci. U. S. A 94, 7001-7005.
24. Couce, M. E., Burguera, B., Parisi, J. E., Jensen, M. D., and Lloyd, R. V. (1997) Localization of leptin receptor in the human brain, Neuroendocr. 66, 145-150.
25. Shioda, S., Funahashi, H., Nakajo, S., Yada, T., Maruta, O., and Nakai, Y. (1998) Immunohistochemical localization of leptin receptor in the rat brain, Neurosci. Lett 243, 41-44.
27. Hoggard, N., Hunter, L., Duncan, J. S., Williams, L. M., Trayhurn, P., and Mercer, J. G. (1997) Leptin and leptin receptor mRNA and protein expression in the murine fetus and placenta, Proc. Natl. Acad. Sci. U. S. A 94, 11073-11078.
28. Hoggard, N., Mercer, J. G., Rayner, D. V., Moar, K., Trayhurn, P., and Williams, L. M. (1997) Localization of leptin receptor mRNA splice variants in murine peripheral tissues by RT-PCR and in situ hybridization, Biochem. Biophys. Res. Commun. 232, 383-387.
29. Kielar, D., Clark, J. S., Ciechanowicz, A., Kurzawski, G., Sulikowski, T., and Naruszewicz, M. (1998) Leptin receptor isoforms expressed in human adipose tissue, Metabolism 47, 844-847.
30. Mattioli, B., Straface, E., Quaranta, M. G., Giordani, L., and Viora, M. (2005) Leptin promotes differentiation and survival of human dendritic cells and licenses them for Th1 priming, J Immunol. 174, 6820-6828.
31. Sierra-Honigmann, M. R., Nath, A. K., Murakami, C., Garcia-Cardena, G., Papapetropoulos, A., Sessa, W. C., Madge, L. A., Schechner, J. S., Schwabb, M. B., Polverini, P. J., and Flores-Riveros, J. R. (1998) Biological action of leptin as an angiogenic factor, Science 281, 1683-1686.
33. Shimon, I., Yan, X., Magoffin, D. A., Friedman, T. C., and Melmed, S. (1998) Intact leptin receptor is selectively expressed in human fetal pituitary and pituitary adenomas and signals human fetal pituitary growth hormone secretion, J Clin. Endocrinol. Metab 83, 4059-4064.
34. Malendowicz, L. K., Rucinski, M., Belloni, A. S., Ziolkowska, A., and Nussdorfer, G. G. (2007) Leptin and the regulation of the hypothalamic-pituitary-adrenal axis, Int. Rev. Cytol. 263, 63-102.
35. Lord, G. M., Matarese, G., Howard, J. K., Baker, R. J., Bloom, S. R., and Lechler, R. I. (1998) Leptin modulates the T-cell immune response and reverses starvation-induced immunosuppression, Nature 394, 897-901.
37. Zhao, Y., Sun, R., You, L., Gao, C., and Tian, Z. (2003) Expression of leptin receptors and response to leptin stimulation of human natural killer cell lines, Biochem. Biophys. Res. Commun. 300, 247-252.
38. Matsuda, J., Yokota, I., Tsuruo, Y., Murakami, T., Ishimura, K., Shima, K., and Kuroda, Y. (1999) Development changes in long-form leptin receptor expression and localization in rat brain, Endocrinology 140, 5233-5238.
39. Morash, B. A., Imran, A., Wilkinson, D., Ur, E., and Wilkinson, M. (2003) Leptin receptors are developmentally regulated in rat pituitary and hypothalamus, Mol. Cell Endocrinol. 210, 1-8.
42. Chen, S. C., Kochan, J. P., Campfield, L. A., Burn, P., and Smeyne, R. J. (1999) Splice variants of the OB receptor gene are differentially expressed in brain and peripheral tissues of mice, J Recept. Signal. Transduct. Res. 19, 245-266.
44. Chan, J. L., Bluher, S., Yiannakouris, N., Suchard, M. A., Kratzsch, J., and Mantzoros, C. S. (2002) Regulation of circulating soluble leptin receptor levels by gender, adiposity, sex steroids, and leptin: observational and interventional studies in humans, Diabetes 51, 2105-2112.
45. Yang, G., Ge, H., Boucher, A., Yu, X., and Li, C. (2004) Modulation of direct leptin signaling by soluble leptin receptor, Mol. Endocrinol. 18, 1354-1362.
47. Chua, S. C., Jr., Liu, S. M., Li, Q., Sun, A., DeNino, W. F., Heymsfield, S. B., and Guo, X. E. (2004) Transgenic complementation of leptin receptor deficiency. II. Increased leptin receptor transgene dose effects on obesity/diabetes and fertility/lactation in lepr-db/db mice, Am. J Physiol Endocrinol. Metab 286, E384-E392.
48. Hekerman, P., Zeidler, J., Bamberg-Lemper, S., Knobelspies, H., Lavens, D., Tavernier, J., Joost, H. G., and Becker, W. (2005) Pleiotropy of leptin receptor signalling is defined by distinct roles of the intracellular tyrosines, FEBS J 272, 109-119.
49. Banks, A. S., Davis, S. M., Bates, S. H., and Myers, M. G., Jr. (2000) Activation of downstream signals by the long form of the leptin receptor, J Biol. Chem. 275, 14563-14572.
50. Bjorbaek, C., Buchholz, R. M., Davis, S. M., Bates, S. H., Pierroz, D. D., Gu, H., Neel, B. G., Myers, M. G., Jr., and Flier, J. S. (2001) Divergent roles of SHP-2 in ERK activation by leptin receptors, J Biol. Chem. 276, 4747-4755.
52. Bjorbaek, C., Elmquist, J. K., Frantz, J. D., Shoelson, S. E., and Flier, J. S. (1998) Identification of SOCS-3 as a potential mediator of central leptin resistance, Mol. Cell 1, 619-625.
54. Elias, C. F., Aschkenasi, C., Lee, C., Kelly, J., Ahima, R. S., Bjorbaek, C., Flier, J. S., Saper, C. B., and Elmquist, J. K. (1999) Leptin differentially regulates NPY and POMC neurons projecting to the lateral hypothalamic area, Neuron 23, 775-786.
56. Cowley, M. A., Smart, J. L., Rubinstein, M., Cerdan, M. G., Diano, S., Horvath, T. L., Cone, R. D., and Low, M. J. (2001) Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus, Nature 411, 480-484.
57. Kristensen, P., Judge, M. E., Thim, L., Ribel, U., Christjansen, K. N., Wulff, B. S., Clausen, J. T., Jensen, P. B., Madsen, O. D., Vrang, N., Larsen, P. J., and Hastrup, S. (1998) Hypothalamic CART is a new anorectic peptide regulated by leptin, Nature 393, 72-76.
59. Mencarelli, M., Walker, G. E., Maestrini, S., Alberti, L., Verti, B., Brunani, A., Petroni, M. L., Tagliaferri, M., Liuzzi, A., and Di Blasio, A. M. (2008) Sporadic mutations in melanocortin receptor 3 in morbid obese individuals, Eur. J Hum. Genet.
61. Harris, M., Aschkenasi, C., Elias, C. F., Chandrankunnel, A., Nillni, E. A., Bjoorbaek, C., Elmquist, J. K., Flier, J. S., and Hollenberg, A. N. (2001) Transcriptional regulation of the thyrotropin-releasing hormone gene by leptin and melanocortin signaling, J Clin. Invest 107, 111-120.
65. Palmer, G., urrand-Lions, M., Contassot, E., Talabot-Ayer, D., Ducrest-Gay, D., Vesin, C., Chobaz-Peclat, V., Busso, N., and Gabay, C. (2006) Indirect effects of leptin receptor deficiency on lymphocyte populations and immune response in db/db mice, J Immunol. 177, 2899-2907.
66. Farooqi, I. S., Wangensteen, T., Collins, S., Kimber, W., Matarese, G., Keogh, J. M., Lank, E., Bottomley, B., Lopez-Fernandez, J., Ferraz-Amaro, I., Dattani, M. T., Ercan, O., Myhre, A. G., Retterstol, L., Stanhope, R., Edge, J. A., McKenzie, S., Lessan, N., Ghodsi, M., De, R., V, Perna, F., Fontana, S., Barroso, I., Undlien, D. E., and O'Rahilly, S. (2007) Clinical and molecular genetic spectrum of congenital deficiency of the leptin receptor, N. Engl. J Med. 356, 237-247.
67. Kowalski, T. J., Liu, S. M., Leibel, R. L., and Chua, S. C., Jr. (2001) Transgenic complementation of leptin-receptor deficiency. I. Rescue of the obesity/diabetes phenotype of LEPR-null mice expressing a LEPR-B transgene, Diabetes 50, 425-435.
68. Cohen, P., Zhao, C., Cai, X., Montez, J. M., Rohani, S. C., Feinstein, P., Mombaerts, P., and Friedman, J. M. (2001) Selective deletion of leptin receptor in neurons leads to obesity, J Clin. Invest 108, 1113-1121.
69. de, L. C., Kowalski, T. J., Zhang, Y., Elmquist, J. K., Lee, C., Kilimann, M. W., Ludwig, T., Liu, S. M., and Chua, S. C., Jr. (2005) Complete rescue of obesity, diabetes, and infertility in db/db mice by neuron-specific LEPR-B transgenes, J Clin. Invest 115, 3484-3493.
70. Morioka, T., Asilmaz, E., Hu, J., Dishinger, J. F., Kurpad, A. J., Elias, C. F., Li, H., Elmquist, J. K., Kennedy, R. T., and Kulkarni, R. N. (2007) Disruption of leptin receptor expression in the pancreas directly affects beta cell growth and function in mice, J Clin. Invest 117, 2860-2868.
71. Huan, J. N., Li, J., Han, Y., Chen, K., Wu, N., and Zhao, A. Z. (2003) Adipocyte-selective reduction of the leptin receptors induced by antisense RNA leads to increased adiposity, dyslipidemia, and insulin resistance, J Biol. Chem. 278, 45638-45650.
72. Bates, S. H., Stearns, W. H., Dundon, T. A., Schubert, M., Tso, A. W., Wang, Y., Banks, A. S., Lavery, H. J., Haq, A. K., Maratos-Flier, E., Neel, B. G., Schwartz, M. W., and Myers, M. G., Jr. (2003) STAT3 signalling is required for leptin regulation of energy balance but not reproduction, Nature 421, 856-859.
73. Bates, S. H., Kulkarni, R. N., Seifert, M., and Myers, M. G., Jr. (2005) Roles for leptin receptor/STAT3-dependent and -independent signals in the regulation of glucose homeostasis, Cell Metab 1, 169-178.
74. Bjornholm, M., Munzberg, H., Leshan, R. L., Villanueva, E. C., Bates, S. H., Louis, G. W., Jones, J. C., Ishida-Takahashi, R., Bjorbaek, C., and Myers, M. G., Jr. (2007) Mice lacking inhibitory leptin receptor signals are lean with normal endocrine function, J Clin. Invest 117, 1354-1360.
75. Ducy, P., Amling, M., Takeda, S., Priemel, M., Schilling, A. F., Beil, F. T., Shen, J., Vinson, C., Rueger, J. M., and Karsenty, G. (2000) Leptin inhibits bone formation through a hypothalamic relay: a central control of bone mass, Cell 100, 197-207.
76. Kim, S., Koga, T., Isobe, M., Kern, B. E., Yokochi, T., Chin, Y. E., Karsenty, G., Taniguchi, T., and Takayanagi, H. (2003) Stat1 functions as a cytoplasmic attenuator of Runx2 in the transcriptional program of osteoblast differentiation, Genes Dev. 17, 1979-1991.
77. Gao, Q., Wolfgang, M. J., Neschen, S., Morino, K., Horvath, T. L., Shulman, G. I., and Fu, X. Y. (2004) Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation, Proc. Natl. Acad. Sci. U. S. A 101, 4661-4666.
79. Ren, D., Li, M., Duan, C., and Rui, L. (2005) Identification of SH2-B as a key regulator of leptin sensitivity, energy balance, and body weight in mice, Cell Metab 2, 95-104.
81. Yiannakouris, N., Yannakoulia, M., Melistas, L., Chan, J. L., Klimis-Zacas, D., and Mantzoros, C. S. (2001) The Q223R polymorphism of the leptin receptor gene is significantly associated with obesity and predicts a small percentage of body weight and body composition variability, J Clin. Endocrinol. Metab 86, 4434-4439.
82. Wauters, M., Mertens, I., Rankinen, T., Chagnon, M., Bouchard, C., and Van, G. L. (2001) Leptin receptor gene polymorphisms are associated with insulin in obese women with impaired glucose tolerance, J Clin. Endocrinol. Metab 86, 3227-3232.
|
Science Writers | Nora G. Smart |
Illustrators | Diantha La Vine |
Authors | Philippe Georgel, Bruce Beutler |