Phenotypic Mutation 'Cpg1' (pdf version)
List |< first << previous [record 78 of 511] next >> last >|
AlleleCpg1
Mutation Type missense
Chromosome9
Coordinate106,225,007 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Leucine changed to Proline
Institutional SourceBeutler Lab
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: L499P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.95; Specificity: 0.80)
(Using ENSMUST00000062241)
Phenotypic Category decrease in response to injected CpG DNA, immune system, MCMV susceptibility, TLR signaling defect: TNF production by macrophages, TLR signaling defect: type I IFN production by macrophages
Penetrance 100% 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 0.99
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.86
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 0.99
IGL02851:Tlr9 APN 9 106224730 nonsense probably null 0.00
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0071:Tlr9 UTSW 9 106223578 missense probably benign 0.00
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.02
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign 0.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.11
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Embryos, Sperm, gDNA
MMRRC Submission 010464-UCD
Last Updated 03/28/2017 1:40 PM by Katherine Timer
Record Created unknown
Record Posted 10/18/2007
Phenotypic Description
The CpG1 phenotype was identified in a G3 screen for mutants with impaired response to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from CpG1 mice produce normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODN) (Figure 1A, B) (1). Homozygous CpG1 macrophages produce no TNF-α, and heterozygous macrophages produce an amount intermediate between homozygous mutant and wild type levels. Thus, the CpG1 mutant allele is semidominant or the wild type allele is haploinsufficient. Interestingly, semidominance is only observed at low (<0.1 µM) CpG ODN concentrations; wild type and CpG1 heterozygous cells respond similarly to a higher (1.0 μM) concentration of CpG ODN. Homozygous CpG1 macrophages also fail to produce interleukin (IL)-12p40 in response to CpG ODN (Figure 1C).
 
CpG1 mice are hypersusceptible to mouse cytomegalovirus (MCMV) infection, as demonstrated by a high splenic viral titer (similar to BALB/c mice) four days after intraperitoneal inoculation with 5 x 105 pfu MCMV (MCMV Susceptibility and Resistance Screen). CpG1 mice succumb by six days post-infection, when wild type mice appear healthy. CpG1 mutants also display impaired MCMV-induced cytokine production; specifically, serum levels of interferon (IFN)-α/β, IFN-γ, and IL-12p40 are significantly reduced compared to wild type when tested 36 hours after infection with 5 X 104 pfu. Likely as a consequence, CpG1 mice have a seven-fold reduction in activated splenic natural killer (NK) cells and a six-fold reduction in NKT cells compared to wild type 36 hours post-infection (as measured by intracellular IFN-γ staining) (1).
 
Although not all of the same phenotypes have been examined, those tested are identical between CpG1, CpG2, CpG3 and CpG5 mice. Sequence analysis revealed that all four strains contain mutations in Tlr9. However, the positions of the mutations differ, with the CpG1, CpG3 and CpG5 mutations located in the sixteenth, sixth and ­­fourteenth extracellular leucine-rich repeats (LRR), respectively, and the CpG2 mutation located in the cytoplasmic Toll/IL-1R (TIR) domain. In addition to CpG1, CpG2, CpG3 and CpG5, another strain of mice, designated effete, also exhibits impaired TNF-α responses to CpG ODN treatment. The mutant has no TLR9 mutation; the causative mutation is under investigation.

 

Nature of Mutation
The CpG1 mutation corresponds to a T to C transition at position 1602 of the Tlr9 transcript, in exon 2 of 2 total exons.
 
1587 GTCAATCTCTCACGCCTCCAGTGTCTTAGCCTG
494  -V--N--L--S--R--L--Q--C--L--S--L-
 
The mutated nucleotide is indicated in red lettering, and causes a leucine to proline substitution at residue 499 of the TLR9 protein.
Protein Prediction
TLR9 is a type I integral membrane glycoprotein containing 1032 amino acids. Like the other TLRs, its cytoplasmic domain (at its C terminus) shares similarity with the interleukin-1 and IL-18 receptors (IL-1R and IL-18R) in a conserved region of approximately 200 amino acids known as the Toll/IL-1R (TIR) domain (2-4), which mediates homo- and heterotypic protein interactions during signal transduction. TIR domains in TLRs and in IL receptors contain 3 conserved boxes (boxes 1, 2 and 3), which are required for signaling (5). In addition, TIR domains contain six α-helices (αA, αB, αC, αC’, αD and αE) and five β-strands (βA, βB, βC, βD and βE) which are connected by seven loops (named for the α-helix and β-strand they connect; e.g. AA connects βA with αA). The crystal structures of the TLR1 and TLR2 TIR domains reveal that they fold into a structure with a central five-stranded parallel β-sheet surrounded by five helices (6) (see the record for languid for a picture of the TLR2 TIR domain). Many of the α-helices and connecting loops are predicted to participate in binding partner recognition, and their mutation is expected to abrogate specific binding interactions. This is true of a proline to histidine mutation in the BB loop of TLR4 (see the record for lps3), which has been reported to abolish MyD88 binding to a constitutively active TLR4 mutant (7) and LPS-induced signaling in mice (8).
 
The extracellular domains of TLRs, unlike those of the interleukin receptors, contain multiple leucine-rich repeats (LRRs), which mediate ligand recognition by TLRs and consist of 24-29 amino acids with two conserved leucine-rich sequences: XLXXLXLXXN (residues 1-10, present in all LRR subtypes) followed by XØXXØX4FXXLX (residues ~11-24, but variable in length, sequence and structure), where X is any amino acid and Ø is a hydrophobic amino acid [discussed in (9)]. TLR9 has 25 such LRRs in its ectodomain encoded by the N-terminal half of the protein (1-4;9). Crystal structures of TLR1, TLR2 (10) and other LRR-containing proteins revealed that the XLXXLXLXXN sequence folds into a β-strand (9). Each LRR forms a loop such that the juxtaposition of several LRR loops forms a horseshoe structure, with the hydrophobic residues of the LRR consensus sequence pointed inward (9). Some of these LRRs contain insertions of up to 16 amino acids following positions 10 or 15 in the LRR consensus sequence, a common occurrence among LRRs of many TLRs. In TLR3, insertions in two of the LRRs extend outward from the convex face of the protein (11-13) (Figure 2; PDB ID 3CIY). For TLR7, 8 and 9, LRRs 2, 5 and 8 contain long insertions following the tenth residue. These insertions, along with an insertion in LRR11, are positioned proximal to the β-strands formed by the first ten residues. These four insertions may contribute to the ligand-binding site  (9). Recent data has shown that TLR9 undergoes proteolytic cleavage at a flexible loop located between LRRs 14 and 15 (14;15).       
 
Figure 3. Protein and domain structure of TLR9. (A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG1 mutation is highlighted. 3D image was created using UCSF Chimera. (B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane (TM) domain (blue) and a cytoplasmic Toll/Interleukin-1 receptor (TIR) domain (green). The CpG1 mutation (red asterisk) results in a leucine to proline change at position 499 of the TLR9 protein in the predicted sixteenth LRR. This image is interactive. Click on the image to view other mutations found in TLR9. Click on each mutation for more specific information.
Tlr9 has at least two alternatively spliced transcripts, encoding proteins with variable extensions at their N termini (3;4). It appears that the predominant form lacks any of the N-terminal extensions (4).
 
The CpG1 mutation results in a leucine to proline change at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain (Figure 3).
Expression/Localization
Northern blot and RT-PCR analysis detects Tlr9 transcript in spleen, lung, liver, lymph node, bone marrow and peripheral blood leukocytes (2-4). Among human peripheral blood mononuclear cells (PBMC), Tlr9 is found at low levels in monocytes, NK cells, T cells, and at higher levels in plasmacytoid dendritic cells (pDCs) and B cells (16). TLR9 is localized in the endoplasmic reticulum (17;18), and at endosomal/lysosomal membranes (18;19).
Background
Figure 4. Overview of Toll-like receptor (TLR) signaling pathways. Shown are the signaling events downstream of TLR activation that ultimately lead to the induction of thousands of genes including TNF and type I IFN, which are critical in activating innate and adaptive immune responses. TLR1,2,4,5 and 6 are located at the cell surface, while TLR3,7, and 9 are localized in the endosome. Once TLR complexes recognize their ligands, they recruit combinations of adaptor proteins (MyD88, TICAM, TRAM, TIRAP) via homophilic TIR domain interactions.

In the MyD88-dependent pathway utilized by all TLRs except TLR3, MyD88 (lime green) recruits IRAK kinases through their death domains (DD). TRAF6 and IRF5 are also recruited to this complex. Phosphorylation of IRAK1 by IRAK4 allows dissociation of IRAK1 and TRAF6. K63 ubiquitination (small light blue circles) of TRAF6 recruits TAK1 and the TAK1 binding proteins, TAB1 and TAB2. Activation of TAK1 leads to activation of MAP kinase cascades and the IKK complex. NEMO polyubiquitination by TRAF6 is necessary for IKK complex function. The IKK complex phosphorylates IκB, p105, and TPL2 (or MAP3K8), resulting in IκB and p105 ubiquitination and degradation (small pink circles), releasing NF-κB into the nucleus and permitting TPL2 to become activated, respectively. Activation of the p38, JNK and ERK1/2 kinases leads to the activation of both CREB and AP1, which in turn induce many target genes. In pDCs, activation of TLR7 and 9 in endosomes recruits MyD88 and IRAK4, which then interact with TRAF6, TRAF3, IRAK1, IKKα, osteopontin (OPN), and IRF7. IRAK-1 and IKKα phosphorylate and activate IRF7, leading to transcription of interferon-inducible genes and production of large amounts of type I IFN.
 
In the TICAM-dependent pathway stimulated by TLR3 or 4 activation, TICAM (bright yellow) recruits polyubiquitinated RIP1, which interacts with the TRAF6/TAK1 complex and leads to NF-κB activation and proinflammatory cytokine induction. TICAM signaling also leads to type I IFN production through phosphorylation and activation of IRF3 by a complex containing TRAF3, TBK1 and IKKe; RIP1 is not required for TICAM-dependent activation of IRF3.

Note that TLR4 signals through the MyD88-dependent pathway from the cell membrane and is subsequently internalized into late endosomes to signal through the TICAM-dependent pathway. When bound to vesicular stomatitis virus glycoprotein G (VSV-G) (far left), TLR4 can signal through TRAM to induce IRF7 activation, a process that is partially dependent on TICAM. Upon viral stimulation, TLR2 may also be internalized into endosomes to activate both IRF3 and IRF7 by an unknown mechanism. LTA = lipoteichoic acid; LP2 = lipopeptide 2. PAM3CSK4 is a triacyl lipopeptide. Phosphorylation events are represented by small yellow circles labeled with a “P”. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

Toll-like receptors (TLRs) play an essential role in the innate immune response as key sensors of invading microorganisms by recognizing conserved molecular motifs found in many different pathogens, including bacteria, fungi, protozoa and viruses. There are 12 TLRs in mice, and 10 in humans, and each receptor recognizes a distinct microbial ligand. TLR9 is specific for double-stranded DNA unmethylated at CpG motifs (2), which is more abundant in prokaryotic genomes than in eukaryotic genomes (20). CpG ODNs are internalized by immune cells and interact with TLR9 proteins within endosomes (17;18;21). After internalization of DNA, endosome acidification occurs (22), as well as the generation of reactive oxygen species (23). It has been shown that proteolytic cleavage of TLR9 in the endolysosomal compartment is necessary both for efficient binding of ligand to the C-terminal fragment that is produced as well as subsequent signaling events (14;15).

 
Structurally distinct classes of synthetic CpG ODNs lead to different biological outcomes when applied to a single cell type, suggesting that ligand recognition is one mechanism for regulating the specificity of the CpG-induced immune response [reviewed in (24)]. Studies using the purified recombinant TLR9 extracellular domain fused to the IgG1-Fc domain initially focused on the sequence specificity of recognition. These studies demonstrated direct binding of recombinant TLR9 to CpG ODN; modification of the core CpG motif sequence altered the affinity of TLR9 for binding (25). Recently, the DNA backbone has been shown to be of significant importance for TLR9 activation by CpG ODN (25-27). Experimental stimulation of TLR9 often utilizes phosphorothioate (PS)-ODN, in which one of the backbone oxygens is replaced by sulfur, rendering these ODN more nuclease-resistant than “natural” ODN with a phosphodiester (PD) backbone. It has now been shown that the requirement for the CpG motif and for its specific sequence is dictated by the PS backbone (26;27). Even non-CpG ODNs with a PD backbone can stimulate TLR9 and cytokine production, and there are less stringent sequence requirements for TLR9 activation by such ODNs (26;27). Thus, non-CpG DNAs (such as the host’s own DNA) may activate TLR9 signaling. The compartmentalization of TLR9 in the endosome has been suggested as a major mechanism for preventing vertebrate DNA from initiating immune responses (27;28).
 
Stimulation by CpG ODNs leads to activation of the MyD88-dependent pathway, ultimately activating cytokine and chemokine gene expression. Upon TLR9 engagement, MyD88, a TIR adaptor protein which mediates signaling downstream of all TLRs except TLR3, is recruited to TLR9, likely to boxes 1 and 2 (see pococurante and lackadaisical) (5) (Figures 4 and 5). Like TLR9 itself, MyD88 has been shown to be recruited to endosomes where retention allows its sustained activation (29). TLR9, like TLR7 and TLR3, additionally depends upon UNC-93B, a 12-spanning intracellular membrane protein, in order to signal (30). Failure of signaling via all of the nucleic acid sensing TLRs, and rather marked immunocompromise, are caused by the 3d mutation, a missense error of UNC-93B. It has been suggested that TLRs 3, 7, 9, and 13 engage in the formation of a macromolecular complex with UNC-93B (31).
 
Briefly, signal transduction from TLR9 continues as follows [reviewed in (32;33)]: IRAK-4 (see otiose), IRAK-1, IRF5 and TRAF6 are recruited to MyD88 at the receptor, where IRAK-4 phosphorylates IRAK-1. Together, IRAK-1 and TRAF6 then dissociate from the receptor. TRAF6 interaction with TAK1 activates TAK1 to phosphorylate the IkB kinase (IKK) complex (see panr2), which goes on to phosphorylate IkB. Phosphorylated IkB is targeted for ubiquitination and degradation, freeing NF-kB to translocate to the nucleus and activate gene expression. In addition to NF-kB, MAP, ERK 1/2 and JNK kinases are activated, leading to activation of target gene expression (22;34). CpG ODNs also lead to MyD88-dependent activation of IRF7 to regulate gene expression. These genes include those encoding IL-6, IL-1, tumor necrosis factor (TNF), IL-12p40, and type I interferon (IFN), cytokines required for the inflammatory response. Together with ligands on antigen-presenting cells (APCs) that bind to activating receptors on lymphocytes, these cytokines mediate adaptive immune activation.
 
Together with TLRs 3, 7, and 8, TLR9 detects bacterial and viral nucleic acids. Thus, pDCs from TLR9-deficient mice fail to produce IFN-α in response to MCMV (35), herpes simplex virus 1 (HSV-1) (36;37) and HSV-2 (38). TLR9 contributes to resistance against Trypanosoma cruzi (39), Trypanosoma brucei (40), and Toxoplasma gondii (41), and cooperates with TLR2 to mediate resistance against Mycobacterium tuberculosis (42). The role of TLR9 in mediating resistance to many other microbes continues to be explored.
Putative Mechanism
The CpG1 mutation substitutes proline for a conserved leucine at position 499 of the TLR9 protein, which lies in the predicted sixteenth LRR module of the TLR9 ectodomain. No tertiary structural data presently exist for TLR9, making it difficult to hypothesize how the CpG1 mutation could affect either ligand binding or receptor dimerization.  Recently, the crystal structure of the related TLR3 heterodimer bound to double-strande (ds) RNA has been elucidated (Figure 2).  Similar to the TLR2/1 ligand-bound heterodimer (10), the ligand-bound TLR3 heterodimer forms an M-shape.  However, unlike Pam3CSK4, dsRNA binds to the concave surfaces of the TLR3 heterodimer at two locations on each ectodomain (13). It has been hypothesized that TLR7, 8 and 9 ligands may also bind to the concave surface of the ectodomain at a site made up by insertions at LRR 2, 5, 8 and 11 (9).  The CpG1 mutation might somehow disrupt ligand binding and/or receptor dimerization, or destroy proper folding or localization of the receptor. The CpG1 phenotype supports any and all of these possibilities.
Primers Primers cannot be located by automatic search.
Genotyping
CpG1 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.
 
Primers for PCR amplification
CpG1(F): 5’- AACTCTTCCTGGTTCCAAGGTCTG -3’
CpG1(R): 5’- GGGTATGAATGTCATTGTGTGCC -3’
 
PCR program
1) 94°C             2:00
2) 94°C             0:15
3) 60°C             0:30
4) 68°C             1:00
5) repeat steps (2-4) 40X
6) 68°C             7:00
7) 4°C               ∞
 
Primers for sequencing
CpG1_seq(F): 5’- CCTTCAACGCTGTCAGAAGCCAC -3’
CpG1_seq(R): same as CpG1(R)
 
The following sequence of 873 nucleotides (from Genbank genomic region NC_000075 for linear DNA sequence of Tlr9) is amplified:
 
1812             aactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct
2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc
2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag
2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcatgga caggtgtaag aacttcaagt
2341 tcaccatgga cctgtctcgg aacaacctgg tgactatcaa gccagagatg tttgtcaatc
2401 tctcacgcct ccagtgtctt agcctgagcc acaactccat tgcacaggct gtcaatggct
2461 ctcagttcct gccgctgact aatctgcagg tgctggacct gtcccataac aaactggact
2521 tgtaccactg gaaatcgttc agtgagctac cacagttgca ggccctggac ctgagctaca
2581 acagccagcc ctttagcatg aagggtatag gccacaattt cagttttgtg acccatctgt
2641 ccatgctaca gagccttagc ctggcacaca atgacattca taccc
 
PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is shown in red text.
References
 11.  Bell, J. K., Botos, I., Hall, P. R., Askins, J., Shiloach, J., Segal, D. M., and Davies, D. R. (2005) The molecular structure of the Toll-like receptor 3 ligand-binding domain, Proc. Natl. Acad. Sci. U. S. A 102, 10976-10980.
Science Writers Alyson Mack, Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsKoichi Tabeta, Bruce Beutler
List |< first << previous [record 78 of 511] next >> last >|
Edit History
01/07/2011 8:59 AM (current)
12/08/2010 3:30 PM
09/07/2010 9:38 AM
08/06/2010 10:11 AM
06/23/2010 10:53 AM
06/23/2010 10:33 AM
06/23/2010 10:25 AM
06/23/2010 10:23 AM
06/23/2010 10:21 AM
06/23/2010 10:19 AM
06/21/2010 1:53 PM
04/29/2010 11:16 AM
04/08/2010 1:46 PM
03/18/2010 9:43 AM
03/18/2010 9:42 AM
03/10/2010 12:12 PM
03/03/2010 10:27 AM