Phenotypic Mutation 'Minions'

• Allele: Minions
• Mutation Type: missense
• Chromosome: 10
• Coordinate: 82,575,079 bp (GRCm39)
• Base Change: C ⇒ A (forward strand)
• Gene: Hcfc2
• Gene Name: host cell factor C2
• Synonym(s): 1700129L13Rik, fkls
• Chromosomal Location: 82,531,994-82,578,262 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two proteins which interact with VP16, a herpes simplex virus protein that initiates virus infection. Both the encoded protein and the original Herpes host cell factor interact with VP16 through a beta-propeller domain. The original Herpes host cell factor, however, is effective at initiating viral infection while the encoded protein is not. Transcripts of varying length due to alternative polyadenylation signals have been described. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for null or severely hypomorphic allele exhibit reduced poly(I:C)-mediated TLR3 signaling and increased mortality following viral infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Threonine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000020478] [ENSMUSP00000124489]
• AlphaFold: Q9D968
• SMART Domains: Protein: ENSMUSP00000020478; Gene: ENSMUSG00000020246; AA Change: T706K

Domain	Start	End	E-Value	Type
Pfam:Kelch_1	22	60	2.1e-6	PFAM
Pfam:Kelch_5	68	106	1.1e-6	PFAM
Pfam:Kelch_3	81	135	8.8e-7	PFAM
Pfam:Kelch_5	186	230	8.4e-7	PFAM
Pfam:Kelch_3	206	253	1.6e-11	PFAM
Pfam:Kelch_1	244	302	7.5e-9	PFAM
Pfam:Kelch_3	254	323	3.4e-7	PFAM
Pfam:Kelch_5	312	356	1.4e-6	PFAM
FN3	357	591	8.43e-9	SMART
FN3	607	703	6.06e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000020478)
• SMART Domains: Protein: ENSMUSP00000124489; Gene: ENSMUSG00000020246; AA Change: T246K

Domain	Start	End	E-Value	Type
FN3	52	131	1.22e1	SMART
FN3	147	243	6.06e-1	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000160681)
• Meta Mutation Damage Score: 0.3314
• Is this an essential gene?: Probably nonessential (E-score: 0.194)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Local Stock: Live Mice
• Last Updated: 2017-10-05 10:14 AM by Anne Murray
• Record Created: 2013-10-11 4:02 PM by Lei Sun
• Record Posted: 2017-10-04
• Science Writers: Eva Marie Y. Moresco, Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Lei Sun

Accession Number

NCBI RefSeq: NM_001081218; MGI: 1915183

Alleles Listed at MGI

none

Phenotypic Description

Figure 1. Macrophages from compound minions/Feckless mice produce reduced levels of TNF in response to poly(I:C) . TNF in the culture medium of macrophages from age-matched heterozygous Feckless , homozygous Feckless , compound heterozygous Feckless/Minions , compound heterozygous Feckless/Scaffold, and wild-type mice. Figure adapted from ( 1 ) .

Figure 2. Minions inhibits poly(I:C) induced activation of MAPK, NF-κB and IRF3 signaling. Western blot analysis comparing the phosphorylation of ERK1/2, p38, JNK, IKKs and Stat1 in compound Feckless/Minions heterozygote to that in wild type (B6) macrophages.

Figure 3. Minions inhibits poly(I:C) induced activation of MAPK signaling. Western blot analysis comparing the phosphorylation of ERK1/2 in compound Feckless/Minions heterozygotes to that in Feckless heterozygote macrophages.

Macrophages from compound heterozgyous Feckless and Minions mice produce reduced amounts of TNF in response to poly(I:C) (1) (Figure 1). Compound heterozygote of Feckless and Minions inhibits poly(I:C) induced phosphorylation of ERK1/2, p38, JNK, IKKs and Stat1 (Figure 2 & 3).

Nature of Mutation

The Minions mutation is a C to A transversion at base pair 82,739,245 (v38) on chromosome 10, or base pair 40,239 in the GenBank genomic region NC_000076 encoding Hcfc2. The mutation corresponds to residue 2,254 in the NM_001081218 mRNA sequence in exon 14 of 15 total exons.

2238 GGCTATGGACCAGCCACACAAGTCCGATGGCTT 701  -G--Y--G--P--A--T--Q--V--R--W--L-

The mutated nucleotide is indicated in red. The mutation results in a threonine (T) to lysine (K) substitution at residue 706.

Protein Prediction

Figure 4. Domain structures of HCF-1, HCF-2, and VP16.  The human HCF proteins are depicted.  The β-propeller domain contains six kelch-like repeats predicted to fold into a six-bladed β-propeller structure.  A proline residue exists at the fourth position of every kelch repeat in each of HCF-1 and HCF-2; mutation of the proline residue in the third kelch repeat of HCF-1 (P) abrogates binding to VP16.  An enlarged schematic of the fifth kelch repeat is shown for HCF-2, with the position of the Minions mutation indicated by a red asterisk.  The eight HCF_PRO repeats of HCF-1 are indicated by open (nonfunctional) and filled (functional) arrowheads.  The SASN, basic, and SASC regions are labeled.  The first 902 amino acids of HCF-1 comprising the β-propeller, SASN domain, and basic region are required to complement the tsBN67 defect.  The β-propeller domain of HCF-1 is necessary and sufficient to bind the HCF-binding motifs of VP16 and Luman.  VP16 contains a 355 amino acid central conserved core and a C-terminal transactivation domain (TAD).  Residues binding to HCF-1 and Oct-1 are indicated. Image is interactive; click to see additional lab alleles of HCF-2 and to connect to the respective pages.

The Minions mutation (T706K) is within the C-terminal self-association domain (SASC). The SASC domain is a 190 amino acid region containing two tandem sequences with homology to fibronectin type 3 (Fn3) repeats [Figure 4; (2)]. The function of the SASC domain is unknown, however in HCF-1 (host cell factor C1; HCF-1 shares 59% sequence identity with HCF-2 at the SASC domain), the SASC domain mediates non-covalent association of the N- and C-terminal portions of the protein after cleavage at one of the HCF_PRO repeats. The SASC and another SAS domain at the N-terminus, SASN, are conserved between HCF-1. However, HCF-2 does not have the eight 26-amino acid HCF_PRO repeats that serve as autoproteolytic cleavage sites for HCF-1 (3). The expression, localization, and stability of the mutant HCF-2 protein have not been examined.

Please see the record Feckless for information about Hcfc2.

Putative Mechanism

HCFC2 facilitates the binding of IRF1/2 to the Tlr3 promoter (namely to the Tlr3 IRF-E) by forming complexes with IRF1/2 (1). In addition to regulating Tlr3 transcription, IRF1/2 and HCFC2 regulate the transcription of several interferon-regulated genes (1). ChIP sequencing determined that 381 DNA binding sites were differentially enriched in either wild-type or Hcfc2-deficient (Hcfc2^-/-) mouse embryonic fibroblasts: 365 DNA sequences were immunoprecipitated at higher levels in wild-type samples, while 16 were immunoprecipitated at higher levels in the Hcfc2^-/- samples. RNA sequencing of Hcfc2^-/- bone marrow-derived macrophages (BMDM) found that 571 genes were differentially expressed in both Hcfc2^-/- and Irf2^-/- BMDMs compared to that in wild-type BMDMs. Analysis of the ChIP and RNA sequencing data showed that 31 genes exhibited reduced association with IRF2 and altered transcript levels in Hcfc2^-/- samples compared to wild-type samples: 13 were significantly reduced and 18 were significantly increased in the Hcfc2^-/- samples. Taken together, HCFC2 is proposed to facilitate IRF2 binding to several target genes, supporting the function of IRF2 as both a transcriptional activator and a repressor. Further analysis determined that HCFC2/IRF2 promotes the expression of known immune response genes that function in immune defense.

Primers

PCR Primer
Minions_pcr_F: TACTTGGCTATCCGCACAGCAC
Minions_pcr_R: AAAGGGGCAATACACCTTACGGC

Genotyping

Minions genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Minions(F): 5’- TACTTGGCTATCCGCACAGCAC-3’

Minions(R): 5’- AAAGGGGCAATACACCTTACGGC-3’

Sequencing Primer

Minions_seq(F): 5’- TATCCGCACAGCACAGATG -3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 523 nucleotides (from Genbank genomic region NC_000076 for linear DNA sequence of Hcfc2) is amplified:

40046                            tactt ggctatccgc acagcacaga tgcaagataa

40081 tccaagccaa cttgtattca tgaggatcta ctgtggtctt aaaacctcat gtacagtgac

40141 tgctgggcag cttgcaaatg cacatattga ttacacatcc agacccgcca ttgtgttcag

40201 aatatccgca aagaatgaaa agggctatgg accagccaca caagtccgat ggcttcaagg

40261 taacagtaag aaagctcctt tgagttgagt tgttttttat taaagctgtt gtgatagtta

40321 tttattagta actggttatg aacatctgtt ctttgagagt attctctgac tgtatttcta

40381 gcagttatga atttgagttt gtaagttgtt cttaaaatgt atttgctcac ttctagatcc

40441 aaataaagat agaaagaagc aaagactgaa aattagtata tggattcttc cttacccata

40501 tagctgctta taaaggaaaa aaaaaatagc aaaatgaaga taaaagccgt aaggtgtatt

40561 gccccttt

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References

  1. Sun, L., Jiang, Z., Acosta-Rodriguez, V. A., Berger, M., Du, X., Choi, J. H., Wang, J., Wang, K., Kilaru, G. K., Mohawk, J. A., Quan, J., Scott, L., Hildebrand, S., Li, X., Tang, M., Zhan, X., Murray, A. R., La Vine, D., Moresco, E. M. Y., Takahashi, J. S., and Beutler, B. (2017) HCFC2 is Needed for IRF1- and IRF2-dependent Tlr3 Transcription and for Survival during Viral Infections. J Exp Med. Oct. 2 [Epub ahead of print].

  2. Wilson, A. C., Boutros, M., Johnson, K. M., and Herr, W. (2000) HCF-1 Amino- and Carboxy-Terminal Subunit Association through Two Separate Sets of Interaction Modules: Involvement of Fibronectin Type 3 Repeats. Mol Cell Biol. 20, 6721-6730.

  3. Vogel, J. L., and Kristie, T. M. (2000) Autocatalytic Proteolysis of the Transcription Factor-Coactivator C1 (HCF): A Potential Role for Proteolytic Regulation of Coactivator Function. Proc Natl Acad Sci U S A. 97, 9425-9430.