Phenotypic Mutation 'swagger' (pdf version)
List |< first << previous [record 504 of 584] next >> last >|
Alleleswagger
Mutation Type nonsense
Chromosome6
Coordinate64,395,280 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Grid2
Gene Name glutamate receptor, ionotropic, delta 2
Synonym(s) GluRdelta2, tpr, B230104L07Rik
Chromosomal Location 63,255,876-64,704,323 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008167; MGI: 95813

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Ref Sequences
Y648* in Ensembl: ENSMUSP00000093536 (fasta)
Gene Model not available
SMART Domains

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 7.5e-32 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
Penetrance Unknown 
Alleles Listed at MGI

All alleles(29) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(2) Transgenic(2) Spontaneous(18) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 unclassified possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3500:Grid2 UTSW 6 63503399 missense probably damaging 0.97
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
Mode of Inheritance Autosomal Recessive
Local Stock Embryos, Sperm, gDNA
Repository

none

Last Updated 2018-05-22 9:43 AM by Anne Murray
Record Created unknown
Record Posted 2009-05-15
Phenotypic Description

The swagger phenotype was identified in three littermates among ENU-mutagenized G3 mice.  Homozygous swagger mice appear somewhat lethargic, with a wobbling gait that is more pronounced upon movement.  They have trouble keeping balance and exhibit an altered gait characterized by exaggerated high stepping of the hind legs.  Swagger mice can swim well; hind limbs perform actively in the water.  Homozygous male mice are sterile.

Nature of Mutation
The swagger mutation was mapped to Chromosome 6, and corresponds to a T to A transversion at position 1944 of the Grid2 transcript, in exon 12 of 16 total exons.

1927 ATTGTCATCTCATCTTATACAGCCAACCTTGCC
643  -I--V--I--S--S--*

 
The mutated nucleotide is indicated in red lettering, and converts the codon for tyrosine 648 to a stop codon.
Protein Prediction
Glutamate receptor ion channels (ionotropic glutamate receptors, iGluR), which are nonselective for monovalent cations (and sometimes Ca2+ permeable), are the major mediators of excitatory synaptic transmission in the central nervous system. Three subtypes, the AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate), kainate, and NMDA (N-methyl-D-aspartate) receptors, were identified pharmacologically, based on their activation by the exogenous agonists after which they are named. A fourth subfamily, which consists of the δ1 and δ2 glutamate receptors (GluRδ1 and GluRδ2), was discovered in 1993 by low stringency screening of mouse and rat brain cDNA libraries using AMPA receptor probes (1-3). The amino acid sequences of GluRδ1 and GluRδ2 are 56% identical to each other, approximately 20-25% identical to AMPA and kainate receptors, and approximately 15-20% identical to NMDA receptors (2;3)
 

Figure 1. Domain organization (top) and membrane topography of GluRδ2 (bottom). The domains are labeled as explained in the text. The SYTANLAAF sequence motif in the M3 transmembrane helix is indicated, with the alanine mutated in Lurcher mice and the tyrosine mutated in swagger mice indicated. The ligand binding pocket formed by the two lobes D1 and D2 is shown as filled with either glycine or D-serine, which have been shown to bind to GluRd2 with low affinity. Not to scale.

iGluRs are tetramers arranged as a dimer of dimers (4-6). Biophysical and structural studies have revealed that each subunit has a characteristic modular architecture with four domains: the N-terminal domain (NTD), the ligand- or agonist-binding domain (LBD), the transmembrane region, and the C-terminal domain (CTD) (Figure 1) [reviewed in (7;8)]. The extracellular NTD, which shares homology with leucine-isoleucine-valine-binding protein (LIVBP), a bacterial periplasmic binding protein, mediates dimer formation and controls heteromer formation among members of the same iGluR subfamily (9). Also localized extracellularly is the LBD, encoded by two polypeptide segments, S1 and S2, which are separated by amino acids that make up part of the transmembrane portion of the protein. S1 and S2 share sequence and structural homology with the bacterial periplasmic proteins lysine-arginine-ornithine-binding protein (LAOBP) and glutamine-binding protein (QBP) (10). The most divergent region in iGluRs is the C-terminal cytoplasmic domain, which varies in size from less than 20 to 500 amino acids, and interacts with kinases, phosphatases, and other postsynaptic density (PSD) proteins. The CTD is important for proper delivery of the receptor to the membrane (11;12), for clustering the receptor at the PSD (13;14), and for maintaining stable localization of the receptor at the PSD (15).
 
Bacterial expression of the AMPA receptor GluR2 S1 and S2 segments joined by a linker produces a soluble, crystallizable protein representing the LBD (5;16;17), a strategy also used to crystallize the putative LBD of GluRδ2 (18). These studies revealed that S1 and S2 form a clam shell-like structure with two lobes, designated D1 and D2. S1 and S2 each contribute amino acids to both lobes. In the GluR2 LBD structure, the agonist binding site is located in the opening between the two lobes. Most iGluR agonists, such as glutamate, AMPA, and kainate, are amino acids, and their α-amino and α-carboxyl groups dock on the D1 lobe. D2 is then attracted by the γ-carboxyl group and rotates (approximately 21° for glutamate or AMPA binding to GluR2) to close the clam shell structure, locking the agonist in its binding pocket. Thus, agonist binding activates the receptor by inducing a switch from a relaxed, expanded conformation in which the two lobes are open, to a closed conformation that sequesters the agonist in the cleft between lobes. Full agonists induce tighter closure of the D1 and D2 lobes than partial agonists (5). Receptor dimers are held together by extensive interactions between D1 residues from their LBDs.
 
Figure 2. Crystal structure of the LBD formed by the fused S1 and S2 segments of GluRd2. Side (A) and top (B) views of the dimer, with Ca2+ ions at the dimer interface. The D-serine bound monomer is shown in (C). UCSF Chimera structure is based on PDB 2V3T (A and B) and 2V3U (C), Naur et al, Proc. Natl. Acad. Sci. U.S.A. 104, 14116-14121 (2007). Click on each 3D structure to view it rotate.
The unliganded GluRδ2 LBD forms a bi-lobed structure, and assembles into a twofold symmetric dimer similar to the GluR2 and NMDA receptor NR1 LBDs (PDB ID 2V3T; Figure 2A and 2B) (18;19). Two Ca2+ ions are bound at the GluRδ2 dimer interface. Isothermal titration calorimetry experiments showed that D-serine and glycine are able to bind to the GluRδ2 LBD with Kd values in the low millimolar range (i.e. with relatively low affinity), the first demonstration of the identity of GluRδ2 ligands. The crystal structure of GluRδ2 bound to D-serine revealed a similar binding mode as D-serine binding to the NMDA receptor NR1 (PDB ID 2V3U; Figure 2C) (19). However, an important hydrogen bond coordinating D-serine in the binding cavity is mediated by different amino acids in GluRδ2 and NR1. Whereas serine 688 anchors the β-hydroxy group of D-serine in NR1, a tyrosine residue (Y543) from the D1-D2 linker region provides this hydrogen bond in GluRδ2. Also, D-serine alone completely fills the ligand binding cavity of GluRδ2, but in NR1, three water molecules are present with D-serine in the binding cavity. Although it is assumedthat GluRδ2 forms ligand-gated ion channels, none of the iGluRagonists including D-serine and glycine, or any other known compound, induce measurable currentresponses from wild type GluRδ2 (3;18). Coexpression of GluRδ2 with other glutamate receptors also failed to elicit current flow. To date, no molecules able to open the GluRδ2 channel have been found.
 
The transmembrane regions of iGluRs form the ion channel pore, and consist of three α-helices (M1, M3, and M4) and a membrane-inserted pore loop (P or M2) (Figure 1). The pore loop determines the ion selectivity of the channel pore (20). The amino acid sequence of the channel pore is highly homologous to that of K+ channels, to which it is related evolutionarily (21;22) (see the record for mayday that describes Kir6.1, a member of inwardly rectifying K+ channels). However, in all iGluRs the channel orientation in the membrane is inverted compared to that of classical K+ channels, and contains an extra transmembrane helix (M4) with essential but unknown function (20;23). In addition, iGluRs are arranged as a dimer of dimers (4-6), while K+ channels are tetramers with four-fold symmetry. The major pore-lining domain of glutamate receptors is the M3 helix, which corresponds to the inner or M2 helix of K+ channels, and is extensively involved in channel gating (24-26). In the NMDA receptor, M3 domains allosterically interact with both the channel gate and the LBD and mediate their coupling, such that ligand binding changes the conformation of TM3 and in turn the probability of channel opening (26). Present in the M3 domain of all glutamate receptors is the sequence motif SYTANLAAF, which is the most highly conserved motif among glutamate receptors.  Mutation of residues in this motif strongly alter channel function (24;25).
 
The swagger mutation occurs within the most highly conserved iGluR motif, the SYTANLAAF sequence within the M3 helix, and converts the tyrosine residue to a stop.
Expression/Localization
GluRδ2 mRNA is exclusively expressed in Purkinje cells of the cerebellum (2;3)(Figure 3). In the adult rat brain, an antibody against a C-terminal domain peptide (also reactive against GluRδ1) detects GluRδ2 reactivity most strongly in the cerebellum, and there in Purkinje cell bodies and postsynaptic densities of spines forming synapses with parallel fibers (27). GluRδ2 mRNA is expressed as early as embryonic day 15 in Purkinje cell neuroblasts (28), but Western blotting shows little cerebellar protein expression until postnatal day 15, when GluRδ2 is dramatically upregulated (27). GluRδ2 appears to be expressed in both dendritic shafts and spines in the early postnatal period, but by postnatal day 21 when Purkinje cells have reached maturity, GluRδ2 becomes restricted to dendritic spines (28;29). Within spines, GluRδ2 is most highly localized at the postsynaptic density of synapses with parallel fibers. 
 
Purkinje cells receive two types of excitatory input, from parallel fibers of granule cells in the granular layer of the cerebellum, or climbing fibers that originate from inferior olivary neurons in the brainstem. Both types of input develop during the first two postnatal weeks, although the timecourse of development differs between them. Climbing fibers begin forming synapses by postnatal day 2, while parallel fibers begin between postnatal days 7-10. Inputs from climbing fibers are restricted to the proximal dendrites of Purkinje cells; parallel fibers synapses are found on the distal portion of the dendritic tree.  At postnatal day 10, GluRδ2 is expressed in both climbing fiber and parallel fiber synapses, but by adulthood, its expression becomes restricted to parallel fiber synapses (30-32). This selective targeting of GluRδ2 to parallel fiber synapses is activity-dependent. Block of neuronal activity with tetrodotoxin (TTX) induces a redistribution of GluRδ2 to all Purkinje cell spines (33)
 
GluRδ2 has also been detected in a population of glial-like cells in rat pineal glands in culture (34).
Background
The amino acid glutamate is the major excitatory amino acid in the mammalian brain, mediating an estimated 50% of all synaptic transmission in the CNS [reviewed in (35)]. Glutamate is synthesized, stored, released from the presynaptic terminal, and acts through both ligand-gated ion channels (ionotropic glutamate receptors) and G-protein coupled receptors (metabotropic glutamate receptors) on postsynaptic neurons. Activation of these receptors accounts for basal excitatory synaptic transmission and synaptic plasticity, such as long-term potentiation (LTP) and long-term depression (LTD) that are thought to underlie learning and memory. Glutamatergic synaptic transmission is implicated in nearly all aspects of normal brain function, including learning, memory, movement, cognition, and development. However, at elevated concentrations that excessively stimulate the same receptors, glutamate acts as a neurotoxin capable of causing extensive neuronal damage and death. Thus, the brain maintains very low intrasynaptic concentrations of glutamate by the action of glutamate transporters present in the plasma membrane of both glial cells and neurons.
 
An array of receptors representing homo- and heteromers of the three subtypes of glutamate receptor is present on neuronal membranes, and transduces signals through increased ion flux and second messenger signaling pathways (see Protein Prediction). The glutamate receptor ion channels display distinct electrophysiological properties, including channel selectivity for Na+, K+, and Ca2+. Glutamate receptors are also characterized by their pharmacological profiles, including sensitivity to glutamate analogues and by the features of the glutamate-elicited current. In these aspects, the two GluRδ proteins, designated as glutamate ion channels based on their sequence similarity to other iGluRs, remain mysterious (1-3). Both GluRδ1 and GluRδ2 are insensitive to common iGluR agonists, and so far no ligand able to activate the wild type channel has been identified (3;18;27)
 
The discovery that the phenotype of Lurcher (Lc) mice is caused by a point mutation in GluRδ2 was an enormous breakthrough in the study of these channels (36). The Lurcher mutation is an alanine to threonine point mutation of the third alanine (A654) within the SYTANLAAF sequence motif of GluRδ2 (36). GluRδ2Lc mutant channels are spontaneously active, permitting a large constitutive cationic current in the absence of ligand. Since no GluRδ2 agonists are known, all electrophysiological characterization of GluRδ2 receptors has focused on the spontaneous activity of mutant channels with the Lurcher mutation. Examination of the current-volage relationship revealed that GluRδ2Lc channel currents are doubly rectified, in that current flows more easily at membrane potentials lower than +20 mV or higher than +70 mV (25;37). This property resembles that of AMPA and kainate receptors which contain, like GluRδ2, a glutamine residue at the tip of the pore loop. Spontaneous current through Lurcher channels is potentiated by extracellular Ca2+ (37), whereas extracellular protons reduce current flow as they do for the NMDA receptor (38). The open GluRδ2Lc channels are blocked by several chemicals that also inhibit NMDA receptors (pentamidine; 9-tetrahydroaminoacridine, 9-THA) (38).
 
Figure 3. Overview of cell types in the cerebellum.  The cerebellum functions in fine motor control.  Cellular components of the cerebellum include Purkinje cells, granule cells, mossy fibers, and deep cerebellar nuclei.  Mossy fibers enter the granule cell layer and synapse onto granule cells. Granule cells, which receive excitatory input from mossy fi bers, send axons into the molecular layer where they split to form parallel fi bers.  Purkinje cell bodies are oriented in a single layer of the cerebellum (Purkinje cell layer), with their characteristic, extensive dendritic arbors occupying the molecular layer within which they receive synaptic input from the parallel fibers.  Climbing fibers originating from the inferior olive split into multiple terminal branches that also innervate Purkinje cell dendrites in the molecular layer.  The deep cerebellar nuclei receive inhibitory input from Purkinje cells and excitatory input from mossy fibers and climbing fibers. The deep cerebellar nuclear cells generate signals that can modify movements already begun.
The function of mutant GluRδ2Lc channels is associated with the semidominant Lurcher phenotype that arose spontaneously in 1954 in the mouse colony of the MRC Harwell, England. Newborn homozygotes have a reduced body weight, lack milk in their stomach, and die within one day after birth, likely due to autonomous death between embryonic day 15 and birth of all large trigeminal motor neurons, which are required for suckling (39)Lurcher heterozygotes are smaller than normal at maturity, but are fertile and have a normal lifespan. Lc/+ mice show a swaying of the hindquarters, a jerky up and down movement, and a tendency to fall in their attempts to walk, which are visible by 12 to 14 days of age (40;41). Walking also involves exaggerated hindlimb flexion. These phenotypes result from the complete cell autonomous loss of Lc/+ cerebellar Purkinje cells from around postnatal day 8 through day 65 (42;43). This is followed by the loss of 90% of granule cells and 75% of inferior olivary neurons (44), due to the loss of their primary target neurons, the Purkinje cells (45)(Figure 3).  Depending on the age of the mutant, Purkinje cell appearance can range from normal to stunted, with multiple primary dendrites (43).
 
The mechanisms of GluRδ2Lc-induced Purkinje cell death have yet to be definitively established, although much research has focused on this topic [reviewed in (46)]. Studies suggest that Lurcher Purkinje cells are apoptotic, as demonstrated by TUNEL staining, increased Bax and Bcl-x expression, and increased pro-caspase 3 levels (47-49). In addition, GluRδ2Lc has been proposed to trigger an autophagic cell death pathway through its failure to sequester the PDZ/coiled domain protein n-PIST and the Bcl-2-interacting protein Beclin (50). Autophagosome-like vesicles have been observed in Lc/+ Purkinje cells (50;51). However, the steps leading from autophagy to death in Lc/+ Purkinje cells are unknown. Increased oxidative stress may also contribute to Purkinje cell death in Lurcher mice (52).
 
The importance of GluRδ2 for other Purkinje cell functions has been demonstrated using mice with a targeted deletion of the protein. GluRδ2-deficient mice display impaired motor coordination, with ataxia observable by postnatal day 12 (53). These mice walk with tottering steps, and lose balance and roll when they rear up on their hind legs. In general they are less active than their wild type littermates. When made to walk on a narrow, elevated runway, Grid2-/- mice walk slowly and frequently slip, unlike wild type mice that run quickly with few slips. Grid2-/- mice also fall off a rotating rod more quickly than wild type mice. The cerebellum of adult Grid2-/- mice shows a normal architecture and characteristic cellular organization, and Purkinje cells have dendritic arbors comparable in size and in number of spines to those of wild type mice. However, the number of spines forming synapses with parallel fibers is reduced by half, aberrant multiple innervation of Purkinje cells by climbing fibers persists in the adult (a one-to-one climbing fiber to Purkinje cell innervation is normal), and numerous free spines are found (54-56). In mice with a floxed allele of Grid2, induction of Cre recombinase specifically in GluRδ2-expressing cells, resulted in progressive shrinking of parallel fiber presynaptic active zones, mismatching between presynaptic active zones and Purkinje cell postsynaptic densities, and the emergence of free spines (57). Together, these findings suggest that GluRδ2 contributes to the stabilization of parallel fiber-Purkinje cell synapses, restricts climbing fiber synapses to proximal dendrites, and prevents ectopic climbing fiber synapse formation.
 
Long term depression (LTD), the persistent, activity-dependent depression of synaptic transmission, is the main form of synaptic plasticity at the parallel fiber-Purkinje cell synapse. GluRδ2 is required for cerebellar LTD, as shown in GluRδ2-deficient cerebellar slices and in cerebellar cultures after knockdown of GluRδ2 expression (53;58;59). LTD is thought to underlie motor learning, and Grid2-/- mice display defects in eye movement, blink conditioning and vestibular compensation (60-62), and develop involuntary spontaneous eye movements synchronized with action potential firing by Purkinje cells (63). Surprisingly, transgenic expression of mutant GluRδ2 proteins in GluRδ2-deficient mice suggest that the CTD, but not the ligand-binding or ion channel capabilities of GluRδ2, is necessary for LTD (64-66). Functional studies with a blocking antibody showed that GluRδ2 may regulate LTD by controlling AMPA receptor endocytosis (67).
 
The 172 amino acid C-terminus of GluRδ2 interacts with a variety of postsynaptic proteins in yeast two-hybrid experiments, several of which are essential for the induction of LTD. GluRδ2 binds directly to the PDZ domain of Shank proteins, which are linked to AMPA receptors via glutamate receptor interacting protein 1 (GRIP1) and to mGluR1 via Homer (68). The CTD of GluRδ2 has also been shown to interact with protein interacting with C kinase 1 (PICK1), a protein required for LTD (69). Finally, GluRδ2 interacts with the MAGUK (membrane-associated guanylate kinase) S-SCAM (synaptic scaffolding molecule), an interaction enhanced upon phosphorylation of the receptor by PKC after LTD induction (14). Despite the identification of numerous interactors, the role of GluRδ2 in LTD is not understood.
Putative Mechanism
The phenotype of swagger mice resembles those of Grid2-/- mice, as well as heterozygous Lurcher mice. Although protein expression of GluRδ2 has not been examined, two reasons suggest that the swagger mutation results effectively in a protein null phenotype rather than a gain-of-function phenotype causing massive Purkinje cell death such as that observed in Lurcher mice. First, the mutation creates a premature stop codon, which is likely to disrupt protein stability and lead to degradation. Second, like the Grid2 null allele and the hotfoot alleles (mainly deletions of portions of the CTD), the swagger mutation is recessive. In contrast, the Lurcher mutation causes death when present in homozygous form. Examination of cerebellar architecture has not been performed in swagger mice.
Primers Primers cannot be located by automatic search.
Genotyping
Swagger genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.  This protocol has not been tested.
 
Primers
swagger (F): 5’- TTGTGAATAGCCCAGTCCTTGGAAAC -3’
swagger (R): 5’-CTGTTACTGATGCTAGAGAAAGAGCAGC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C               ∞
 
Primers for sequencing
swagger_seq(F): 5’- GCCCAGTCCTTGGAAACAAAATATG -3’
swagger_seq(R): 5’- GTGACACCTGGAATTATGCCTAC -3’
 
The following sequence of 1135 nucleotides (from Genbank genomic region NC_000072 for linear genomic sequence of Grid2 [Chr6:64394888-64396022) is amplified:
 
ttgtgaatag cccagtcctt ggaaacaaaa tatgtatttg tgactataat aaggaattga
ttttagaatt aaaggagaaa gaattatcat ttcaatgtat tttgtagaat atttatcatg
cttcttttta acacagccag acataattcc atagaagatc atcaaaaacc aagtattaaa
atatggaggt ctccagagtt tttaagggaa acgtttcttg ttgtctgtct tggcactgaa
tgtgtatgac ttcagtttct caataaaagc atattgatgt tgttgtcatc tctcctcttt
ccacaggtgg ggaagtccca tacacaactc tggcaacccg aatgatgatg ggggcttggt
ggttatttgc tctgattgtc atctcatctt atacagccaa ccttgccgct ttcctcacta
tcacccgcat tgagagctcc atccagtaag taggcataat tccaggtgtc accaaacctg
acaaatgctg ggcatgccac aaggaaagcc ctctgcacat aaagttgcac taccttataa
taaattgtca ctctcttttt gacaagaagc ttaatcctat gattcttcag aatatcaatc
ctaaataatt tattttataa aatgttgatt ataacttaat tctgtatttt cctggaataa
taacagatca tcaaaaattt aaccttcata gaggatagct atgtcagggc aggagaaatt
attcaaaacc atcctcaact tcatttcaca gagatctcat atcctctatt gactctaaca
tcattgcaca tgcatagtga cagacataca tggatgcaga agcataaaat aaaaataagt
aaatctttaa acataaacta tgtcagagaa aaattatgaa aaaaaaagta taaataattt
taggaaatta aaatgccctt ttttaaaata agtttgtgca atcacagttg atggctaaat
ttattctgtg ggtgagggag taaggagaga agaggacaat ggaagataag aagagagagg
ggaaaagagg atagcaggta acagaaactc tatcatagtg accacattct gtttcttgtc
tgcattaata cccacgtggc caacactgct gctctttctc tagcatcagt aacag
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsLei Sun, Alyson Affleck, Bruce Beutler
List |< first << previous [record 504 of 584] next >> last >|
Edit History
2011-02-01 1:51 PM (current)
2010-10-13 3:26 PM
2010-10-13 3:26 PM
2010-02-03 10:40 AM