Phenotypic Mutation 'mount_tai'

• Allele: mount_tai
• Mutation Type: missense
• Chromosome: 8
• Coordinate: 72,136,021 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Jak3
• Gene Name: Janus kinase 3
• Chromosomal Location: 72,129,027-72,143,221 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired B cell development, small thymi and T cell proliferate. Point mutation homozygotes develop autoimmune inflammatory bowel disease, decreased susceptibility to malaria infection and/or increased susceptibility to bacterial infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000060073] [ENSMUSP00000105639] [ENSMUSP00000105640]
• AlphaFold: no structure available at present
• SMART Domains: Protein: ENSMUSP00000060073; Gene: ENSMUSG00000031805; AA Change: Y607C

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000051995)
• SMART Domains: Protein: ENSMUSP00000105639; Gene: ENSMUSG00000031805; AA Change: Y607C

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000110012)
• SMART Domains: Protein: ENSMUSP00000105640; Gene: ENSMUSG00000031805; AA Change: Y607C

Domain	Start	End	E-Value	Type
B41	20	254	2.2e-42	SMART
SH2	370	460	5.57e-8	SMART
low complexity region	488	503	N/A	INTRINSIC
STYKc	517	773	3.58e-12	SMART
TyrKc	818	1091	4.59e-105	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000110013)
• Meta Mutation Damage Score: 0.9179
• Is this an essential gene?: Possibly essential (E-score: 0.664)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• MMRRC Submission: 038160-MU
• Last Updated: 2019-09-04 9:49 PM by Diantha La Vine
• Record Created: 2014-01-27 6:17 PM by Ming Zeng
• Record Posted: 2015-02-10
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Ming Zeng, Kuanwen Wang, Jin Choi, Bruce Beutler

Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Alleles Listed at MGI

All mutations/alleles(23) : Chemically induced (ENU)(3) Gene trapped(14) Spontaneous(1) Targeted(5)

Phenotypic Description

Figure 1. Homozygous mount tai mice exhibit a reduced frequency of peripheral T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous mount tai mice exhibit an increase in the CD4 + to CD8 + T cell ratio . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous mount tai mice exhibit an increased frequency of CD4 + T cells in CD3 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Homozygous mount tai mice exhibit an reduced frequency of CD8 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Homozygous mount tai mice exhibit a reduced frequency of CD8 + T cells in CD3 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Homozygous mount tai mice exhibit an increased frequency of effector memory CD4 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Homozygous mount tai mice exhibit an increased frequency of effector memory CD8 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Homozygous mount tai mice exhibit a decreased frequency of naïve CD8 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 9. Homozygous mount tai mice exhibit enhanced CD44 mean fluorescence intensity on CD4 + T cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 10. Homozygous mount tai mice exhibit increased total IgE levels in the peripheral blood. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 11. Homozygous mount tai mice exhibit an increased frequency of peripheral neutrophils . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 12. Homozygous mount tai mice exhibit a decreased frequency of peripheral natural killer (NK) cells . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 13. Homozygous mount tai mice exhibit susceptibility to MCMV. Viral titers were measured in the liver. Log of the data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 14. Homozygous mount tai mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mount tai phenotype was identified among G3 mice of the pedigree R0612, some of which showed a reduced frequency of T cells (Figure 1), an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 2) due to an increased frequency of CD4⁺ T cells in CD3⁺ T cells (Figure 3) with a concomitant reduced frequency of CD8⁺ T cells (Figure 4) and CD8⁺ T cells in CD3⁺ T cells (Figure 5), all in the peripheral blood. Some mice also exhibited an increased frequency of effector memory CD4⁺ (Figure 6) and CD8⁺ (Figure 7) T cells, a decreased frequency of naïve CD8⁺ T cells (Figure 8), an increase in the CD44 mean fluorescence intensity (MFI) on CD4⁺ T cells (Figure 9), an increased level of total IgE (Figure 10), an increased frequency of neutrophils (Figure 11), and a decreased frequency of natural kller (NK) cells (Figure 12), all in the peripheral blood. Some mice also exhibited increased mouse cytomegalovirus (MCMV) viral titer in the liver after MCMV infection (Figure 13). The T-dependent antibody response to ovalbumin administered with aluminum hydroxide was also diminished (Figure 14).

Nature of Mutation

Figure 9. Linkage mapping of the increased amount of total IgE levels in the peripheral blood using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 87 mutations (X-axis) identified in the G1 male of pedigree R0612. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 87 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Jak3: an A to G transition at base pair 71,683,377 (v38) on chromosome 8, or base pair 6,995 in the GenBank genomic region NC_000074 encoding Jak3. The strongest association was found with a recessive model of linkage to the normalized total IgE levels in the peripheral blood, wherein two variant homozygotes departed phenotypically from 9 homozygous reference mice and 13 heterozygous mice with a P value of 1.09 x 10^-18 (Figure 15).  The mutation corresponds to residue 2,030 in the mRNA sequence NM_010589 within exon 14 of 25 total exons.

2014 GGAGCAATTGACATGTACCTGCGCAAGCGTGGC 602  -G--A--I--D--M--Y--L--R--K--R--G-

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at position 607 (Y607C) in the JAK3 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.00).

Protein Prediction

Figure 16. Domain structure of JAK3. The mount_tai mutation results in a tyrosine to cysteine substitution at position 607. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive. Other mutations found in JAK3 are noted in red. Click on each mutation for more information.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 16; reviewed in (1)]. The JH1 region corresponds to the kinase domain located at the JAK3 C-terminus (amino acids 818-1091). Amino acids 824-832 within the kinase domain comprise an ATP-binding motif (GXGXXG). Lys851 is also essential for ATP binding; mutation of Lys851 to arginine (Lys851Arg) results in loss of kinase activity (2;3). Amino acids 988-993 comprise a conserved FWYAPE consensus motif found in kinase domains of proteins within the JAK kinase family (3). A pseudokinase domain [i.e., the JH2 region; (amino acids 517-773)] is N-terminal to the JH1 region. The pseudokinase domain does not have catalytic activity, but it is required for suppression of basal JAK3 activity as well as for cytokine-inducible activation of JAK3-assoiciated signal transduction through interactions with signal transducers and activators of transcription (STAT) proteins [see the domino page for information about STAT proteins; (4)]. Mutations within the JH2 domain can result in increased JAK3 kinase activity (5;6) or can increase the inhibitory effect of the JH2 domain, resulting in suppression of the kinase activity and subsequent abolished interleukin (IL)-2 signaling (7;8). The JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460). The function of the SH2-like domain is unknown [(4); reviewed in (1)]. The JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The FERM domain is required for the interactions between JAK3 and gamma chain (γ_c) subunit-containing cytokine receptors (see the “Background” section for more details). The FERM domain interacts with the kinase domain as well as the SH2 domain to modulate JAK3 kinase activity [(9); reviewed in (1)]. Mutations with the FERM domain have been show to either reduce or increase the kinase activity (10;11).

JAK3 function is regulated by phosphorylation/dephosphorylation, inhibitor binding, and ubiquitin proteasome-mediated degradation (12). JAK3 autophosphorylation at Tyr781 upon IL-2 stimulation promotes binding of the SH2 domain-containing adaptor protein SH2-Bβ, which can both inhibit the basal activity of JAK3 and enhance the cytokine-stimulated kinase activity of JAK3 [reviewed in (1)]. Tyr976 and Tyr991 within the activation loop (A-loop) are autophosphorylated upon activation of JAK3 [(4); reviewed in (13)]. Src homology 2 domain-containing phosphatase-1 (SHP-1) as well as T cell protein-tyrosine phosphatase (TCPTP) dephosphorylate JAK3 (14). The E3 ubiquitin ligases suppressors of cytokine signaling (SOCS) and cytokine signaling inducible SH2 domain-containing proteins ubiquitinate JAK3, promoting proteasome-dependent degradation of JAK3 (15).

The mount_tai mutation (Y607C) is within the pseudokinase domain of JAK3.

Expression/Localization

JAK3 is mainly expressed in hematopoietic cells (3;16-18). Highest JAK3 expression is in the adult and fetal thymus, followed by slightly lower levels in bone marrow, spleen, fetal liver, and adult CD4⁻ CD8⁻ double-negative (DN) thymocytes (2). JAK3 is expressed at comparable levels in human peripheral blood B cells and T cells (18). Expression of JAK3 has also been noted in erythrocytes (19) and in the colonic mucosa of mice (20). Slight expression of JAK3 has also been detected in the brain, spinal cord, heart, skeletal muscle, liver, pancreas, prostate, kidney, and lung as well as in epithelial cancer cells, including primary breast cancer and cell lines (SW480: colorectal adenocarcinoma, A549: lung carcinoma, and G361: melanoma) [reviewed in (13)].

Background

Figure 17. JAK-STAT Pathway. Cytokine receptors are associated with the normally dephosphorylated and inactive JAK tyrosine kinases. Latent STAT1 exists in the cytoplasm as a monomer. Upon receptor stimulation, JAK proteins phosphorylate the receptor cytoplasmic domains. STAT proteins are recruited to the receptor, tyrosine phosphorylated by JAKs, and dimerize for translocation to the nucleus with the assistance of importin-α5 (associated with importin-β). Once STAT1 binds to its DNA target, importin-α5 is recycled to the cytoplasm by the cellular apoptosis susceptibility protein (CAS) export receptor. Suppressors of cytokine signaling (SOCS) proteins can directly bind and suppress JAKs or can compete with STATs for receptor binding. The tyrosine phosphatases SHP1 and SHP2 inhibit signaling by dephosphorylating STAT proteins.

The canonical signaling pathway activating STAT proteins, called the JAK-STAT pathway, begins with the binding of one or more cytokines to their cognate cell-surface receptors (Figure 17). These receptors are associated with JAK tyrosine kinases, which are normally dephosphorylated and inactive. Receptor stimulation results in dimerization/oligomerization and subsequent apposition of JAK proteins, which are now capable of trans-phosphorylation as they are brought in close proximity. This activates JAKs to phosphorylate the receptor cytoplasmic domains, creating phosphotyrosine ligands for the SH2 domains of STAT proteins. Once recruited to the receptor, STAT proteins are also tyrosine phosphorylated by JAKs, a phosphorylation event which occurs on a single tyrosine residue that is found at around residue 700 of all STATs. Tyrosine phosphorylation of STATs may allow formation and/or conformational reorganization of the activated STAT dimer, involving reciprocal SH2 domain-phosphotyrosine interactions between STAT monomers. Phosphorylated, activated STATs enter the nucleus and accumulate there to promote transcription (21). For more information on JAK/STAT signaling, please see the record for domino.

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γ_c receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γ_c receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in NK cell differentiation, IL-4 functions in B-cell maturation and isotype switching (22). JAK3 mutations result in defective γ_c receptor-associated signaling and subsequent defects in lymphocyte development (22-24). For example, JAK3 expression is required for T cell proliferation and maintenance of T cell number (25). Jak3 knockout (Jak3^-/-) mice exhibit defects in early T cell development (26;27). In the rudimentary thymus of the Jak3^-/- mice there are normal ratios of DN, CD4⁺ CD8⁺ double-positive (DP), and CD4⁺ and CD8⁺ single-positive cells, but in the periphery, the numbers of CD8⁺ cells is reduced (17;28). Thymocytes and peripheral T cells in Jak3^-/- mice exhibited defective negative selection of self-reactive T cells in the thymus and the periphery (29). Soldevilla et al. proposed that the T cell developmental defect was partially caused by decreased migration of thymic progenitors from the bone marrow to the thymus and/or reduced migration through the thymic compartments due to impaired chemokine receptor signaling (30).

Resting T cells in the Jak3^-/- mice were larger than those in wild-type mice and they expressed high levels of CD44 and CD69 and low levels of CD62L (see the record for dim­_sum), hallmarks of activated T cells (28;31). Jak3-deficient T cells could be activated in vitro by CD3 plus CD28 stimulation. The T cells from the Jak3^-/- mice were anergic, exhibiting reduced proliferation in response to mitogenic stimuli and exogenous IL-2 and increased rates of apoptosis (17;25;27;31-34). The reduced rate of proliferation was due to impaired IL-2- and IL-7-associated signaling with a concomitant increase in the anti-proliferative cytokines, IL-10 and transforming growth factor (TGF)-β. Th2 cell differentiation was not induced upon the loss of JAK3 expression due to loss of IL-4-associated signaling (i.e., STAT6 activation and GATA binding protein 3 induction) (35;36). Loss of JAK3 expression led to reduced T-bet binding to the IFN-γ promoter and subsequent impaired production of IFN-γ (37). Thymocytes from Jak3^-/- mice were apoptotic at or just before TCRβ-chain selection (38). JAK3 regulated T lymphopoiesis by repressing Bax expression as well Bcl-2 induction in the IL-7 survival pathway (34;38).

JAK3 has several additional functions: (i) In T lymphocytes, JAK3 functions in CXCR4-, CCR9-, and CCR7-mediated signaling in response to CXCL12, CCL25, and CCL21/19, respectively (30;39). CCL25 and CXCL12 are known to function in thymocyte migration (30). (ii) JAK3 is a putative negative regulator of STAT1- and STAT3-mediated myogenic differentiation (40). (iii) JAK3 functions during mucosal differentiation in the colon, basal colonic inflammation, and susceptibility to dextran sulfate sodium (DSS)-induced colitis through the regulation β-catenin localization to adherens junctions, expression of differentiation markers (villin, carbonic anhydrase, Muc2), and maintenance of epithelial barrier functions (20;41;42). (iv) JAK3 regulates cytoskeletal remodeling and wound repair through an interaction with the actin-binding protein villin (9;42). (v) Inhibition of JAK3 led to loss of thrombin-induced STAT1 and STAT3 phosphorylation as well as thrombin-induced degranulation and platelet aggregation (43). (vi) JAK3 expression in nonhematopoietic cells is required for the recruitment of inflammatory cells (Th2 and eosinophils) to the airways of OVA-sensitized mice challenged with ovalbumin (44). (vii) JAK3 functions in mast cell-mediated recruitment of neutrophils to the sites of infection in a mouse model of E. coli-induced acute peritonitis (45). Jak3^-/- mice exhibit an impaired efficiency to clear the bacteria compared to wild-type mice (45). Jak3^-/- mast cells released less TNFα in response to E. coli and exhibited a reduced ability to kill phagocytized bacteria (45). (viii) JAK3 negative regulates TLR4-mediated inflammatory responses through the differential regulation of pro- and anti-inflammatory cytokine production (46). JAK3 inhibition in human primary monocytes and macrophages resulted in attenuated TLR4-associated PI3K activation resulting in reduced Akt and GSK3β phosphorylation leading to increased pro-inflammatory cytokine (TNF-α, IL-6, and IL-12) expression and repressed IL-10 production (46). (ix) Dendritic cells (DCs) from Jak3^-/- mice exhibited reduced expression of costimulatory molecules compared to those in wild-type mice (47). In addition, exposure of mature Jak3^-/- DCs to CCL19 and CCL21 resulted in impaired chemotactic responses compared to that in wild-type DCs (47). DC-mediated T cell activation was reduced upon the loss of Jak3 expression. JAK3 is not required for DC development, but is required to negatively regulated DC apoptosis and cytokine production (48). Jak3^-/- DCs produced higher levels of IL-12 and IL-10 upon TLR ligand (LPS, peptidoglycan (PGN), zymosan, and CpG oligonucleotides) stimulation. Wild-type T cells responded to Jak3^-/- DCs and produced high levels of IFN-γ (48). (x) JAK3 mediates actin cytoskeleton rearrangement in response to CXCL12 and CCL21 and through an interaction with cofilin and regulation of Rac1 and RhoA activation (49). Upon chemokine stimulation, the JAK3 signaling pathway is activated leading to activation of Rac1 and actin polymerization at the cell edge sensing the chemokine gradient. JAK3-mediated Rac1 activation promotes leading edge formation (49).

Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [T⁻B⁺NK^- SCID; OMIM: #600802; (8;50;51); reviewed in (22)]. Patients with T⁻B⁺NK^- SCID do not have T or NK cells (50;51). The patients have normal to elevated numbers of immature B lymphocytes, but the cells are nonfunctional. Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity. Mutations in JAK3 have also been linked to adult T cell leukemia/lymphoma, early T cell precursor acute lymphoblastic leukemia (TdT+:ALL), T-cell prolymphocytic leukemia (T-PLL), acute megakaryoblastic leukemia (AMKL), cutaneous T cell lymphoma, and extranodal nasal-type natural killer cell lymphoma (5;11;52-54).

Putative Mechanism

A mouse (Jak3^W81R) with a missense mutation (W81R) affecting the FERM domain had low numbers of CD8⁺ T cells in the spleen and thymus, a low number of NK cells in the thymus and spleen, low numbers of B cells in the bone marrow, and an atrophied thymus (55). Six weeks after exposure to M. bovis BCG, the Jak3^W81R mice exhibited splenomegaly and increased splenic bacterial counts compared to the wild-type control (55). After exposure to M. tuberculosis H37Rv, most Jak3^W81R mice exhibited lethality (55). The Jak3^W81R mice exhibited a cerebral malaria protective effect (55). Jak3^-/- mice have reduced numbers of T, B, γδ T, and NK cells (17;27;28;32;38;44). Jak3^-/- mice had defects in B cell maturation and NK cell development (17;27;32;56). B cell maturation in the Jak3^-/- mice was blocked at the pre-B stage, leading to a reduced frequency IgM⁺ B cells (32;33). Jak3^-/- mice had increased immature neutrophils and monocytes in the periphery as well as splenomegaly and a lack of peripheral lymph nodes and Peyer’s patches (24;39). Bone marrow-derived dendritic cell maturation was normal (48). Jak3^-/- mice exhibited reduced responses to LPS, PMA, ionomycin, concanavalin A, IL-2, IL-7, anti-CD3, and anti-CD28 alone or in combination (56). Mutations in the pseudokinase domain of JAK3 can either cause increased or suppressed JAK3 kinase activity (5-8). The phenotype observed in the mount_tai mice indicates that JAK3^mount_tai exhibits loss of JAK3 function.

Primers

PCR Primer
mount_tai_pcr_F: CCTTGCCAGCTAATTGCTATGCAAC
mount_tai_pcr_R: TTGACACTTACAGCCCTCTGAGCC

Sequencing Primer
mount_tai_seq_F: CAGCTAATTGCTATGCAACATTCC
mount_tai_seq_R: GAGCCTGCTCACGTCATTC

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 473 nucleotides is amplified (chromosome 8, + strand):

1   ccttgccagc taattgctat gcaacattcc ctcccacccc accccgtgcc aacccctcct
61  gaatcttggc tgtatctatt cagttgagct gataggaaac agaagtccag cctgtgcaaa
121 gagcagaggg aagatggggg cagggcctgc tgagtacctg tcacctgaat caccaccacc
181 ccactctccc cctgtcccca ggcatcatgg tgcaggaatt tgtgtatcta ggagcaattg
241 acatgtacct gcgcaagcgt ggccacctgg tgtcagccag ctggaaactg caggtgacca
301 agcagctggc atatgccctt aactacttgg tgagtgtccc tgtgtccata aggaggcttc
361 ctctatggat ggggaaatga gagtaggttc tgtagtttgg ataggagctt ggtaaggaca
421 caagcaaacg ttccagaatg acgtgagcag gctcagaggg ctgtaagtgt caa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Wu, W., and Sun, X. H. (2012) Janus Kinase 3: The Controller and the Controlled. Acta Biochim Biophys Sin (Shanghai). 44, 187-196.

  2. Gurniak, C. B., and Berg, L. J. (1996) Murine JAK3 is Preferentially Expressed in Hematopoietic Tissues and Lymphocyte Precursor Cells. Blood. 87, 3151-3160.

  3. Kawamura, M., McVicar, D. W., Johnston, J. A., Blake, T. B., Chen, Y. Q., Lal, B. K., Lloyd, A. R., Kelvin, D. J., Staples, J. E., and Ortaldo, J. R. (1994) Molecular Cloning of L-JAK, a Janus Family Protein-Tyrosine Kinase Expressed in Natural Killer Cells and Activated Leukocytes. Proc Natl Acad Sci U S A. 91, 6374-6378.

  4. Saharinen, P., and Silvennoinen, O. (2002) The Pseudokinase Domain is Required for Suppression of Basal Activity of Jak2 and Jak3 Tyrosine Kinases and for Cytokine-Inducible Activation of Signal Transduction. J Biol Chem. 277, 47954-47963.

  5. Walters, D. K., Mercher, T., Gu, T. L., O'Hare, T., Tyner, J. W., Loriaux, M., Goss, V. L., Lee, K. A., Eide, C. A., Wong, M. J., Stoffregen, E. P., McGreevey, L., Nardone, J., Moore, S. A., Crispino, J., Boggon, T. J., Heinrich, M. C., Deininger, M. W., Polakiewicz, R. D., Gilliland, D. G., and Druker, B. J. (2006) Activating Alleles of JAK3 in Acute Megakaryoblastic Leukemia. Cancer Cell. 10, 65-75.

  6. Cornejo, M. G., Kharas, M. G., Werneck, M. B., Le Bras, S., Moore, S. A., Ball, B., Beylot-Barry, M., Rodig, S. J., Aster, J. C., Lee, B. H., Cantor, H., Merlio, J. P., Gilliland, D. G., and Mercher, T. (2009) Constitutive JAK3 Activation Induces Lymphoproliferative Syndromes in Murine Bone Marrow Transplantation Models. Blood. 113, 2746-2754.

  7. Chen, M., Cheng, A., Candotti, F., Zhou, Y. J., Hymel, A., Fasth, A., Notarangelo, L. D., and O'Shea, J. J. (2000) Complex Effects of Naturally Occurring Mutations in the JAK3 Pseudokinase Domain: Evidence for Interactions between the Kinase and Pseudokinase Domains. Mol Cell Biol. 20, 947-956.

  8. Candotti, F., Oakes, S. A., Johnston, J. A., Giliani, S., Schumacher, R. F., Mella, P., Fiorini, M., Ugazio, A. G., Badolato, R., Notarangelo, L. D., Bozzi, F., Macchi, P., Strina, D., Vezzoni, P., Blaese, R. M., O'Shea, J. J., and Villa, A. (1997) Structural and Functional Basis for JAK3-Deficient Severe Combined Immunodeficiency. Blood. 90, 3996-4003.

  9. Mishra, J., Karanki, S. S., and Kumar, N. (2012) Identification of Molecular Switch Regulating Interactions of Janus Kinase 3 with Cytoskeletal Proteins. J Biol Chem. 287, 41386-41391.

  10. Zhou, Y. J., Chen, M., Cusack, N. A., Kimmel, L. H., Magnuson, K. S., Boyd, J. G., Lin, W., Roberts, J. L., Lengi, A., Buckley, R. H., Geahlen, R. L., Candotti, F., Gadina, M., Changelian, P. S., and O'Shea, J. J. (2001) Unexpected Effects of FERM Domain Mutations on Catalytic Activity of Jak3: Structural Implication for Janus Kinases. Mol Cell. 8, 959-969.

  11. Elliott, N. E., Cleveland, S. M., Grann, V., Janik, J., Waldmann, T. A., and Dave, U. P. (2011) FERM Domain Mutations Induce Gain of Function in JAK3 in Adult T-Cell leukemia/lymphoma. Blood. 118, 3911-3921.

  12. Alexander, W. S., and Hilton, D. J. (2004) The Role of Suppressors of Cytokine Signaling (SOCS) Proteins in Regulation of the Immune Response. Annu Rev Immunol. 22, 503-529.

  13. Cornejo, M. G., Boggon, T. J., and Mercher, T. (2009) JAK3: A Two-Faced Player in Hematological Disorders. Int J Biochem Cell Biol. 41, 2376-2379.

  14. Simoncic, P. D., Lee-Loy, A., Barber, D. L., Tremblay, M. L., and McGlade, C. J. (2002) The T Cell Protein Tyrosine Phosphatase is a Negative Regulator of Janus Family Kinases 1 and 3. Curr Biol. 12, 446-453.

  15. Yasukawa, H., Sasaki, A., and Yoshimura, A. (2000) Negative Regulation of Cytokine Signaling Pathways. Annu Rev Immunol. 18, 143-164.

  16. Rane, S. G., and Reddy, E. P. (1994) JAK3: A Novel JAK Kinase Associated with Terminal Differentiation of Hematopoietic Cells. Oncogene. 9, 2415-2423.

  17. Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995) Defective Lymphoid Development in Mice Lacking Jak3. Science. 270, 800-802.

  18. Tortolani, P. J., Lal, B. K., Riva, A., Johnston, J. A., Chen, Y. Q., Reaman, G. H., Beckwith, M., Longo, D., Ortaldo, J. R., Bhatia, K., McGrath, I., Kehrl, J., Tuscano, J., McVicar, D. W., and O'Shea, J. J. (1995) Regulation of JAK3 Expression and Activation in Human B Cells and B Cell Malignancies. J Immunol. 155, 5220-5226.

  19. Bhavsar, S. K., Gu, S., Bobbala, D., and Lang, F. (2011) Janus Kinase 3 is Expressed in Erythrocytes, Phosphorylated upon Energy Depletion and Involved in the Regulation of Suicidal Erythrocyte Death. Cell Physiol Biochem. 27, 547-556.

  20. Mishra, J., Verma, R. K., Alpini, G., Meng, F., and Kumar, N. (2013) Role of Janus Kinase 3 in Mucosal Differentiation and Predisposition to Colitis. J Biol Chem. 288, 31795-31806.

  21. Schindler, C., Shuai, K., Prezioso, V. R., and Darnell, J. E.,Jr. (1992) Interferon-Dependent Tyrosine Phosphorylation of a Latent Cytoplasmic Transcription Factor. Science. 257, 809-813.

  22. Notarangelo, L. D., Mella, P., Jones, A., de Saint Basile, G., Savoldi, G., Cranston, T., Vihinen, M., and Schumacher, R. F. (2001) Mutations in Severe Combined Immune Deficiency (SCID) due to JAK3 Deficiency. Hum Mutat. 18, 255-263.

  23. Thomis, D. C., and Berg, L. J. (1997) The Role of Jak3 in Lymphoid Development, Activation, and Signaling. Curr Opin Immunol. 9, 541-547.

  24. Rane, S. G., Mangan, J. K., Amanullah, A., Wong, B. C., Vora, R. K., Liebermann, D. A., Hoffman, B., Grana, X., and Reddy, E. P. (2002) Activation of the Jak3 Pathway is Associated with Granulocytic Differentiation of Myeloid Precursor Cells. Blood. 100, 2753-2762.

  25. Sohn, S. J., Forbush, K. A., Nguyen, N., Witthuhn, B., Nosaka, T., Ihle, J. N., and Perlmutter, R. M. (1998) Requirement for Jak3 in Mature T Cells: Its Role in Regulation of T Cell Homeostasis. J Immunol. 160, 2130-2138.

  26. Baird, A. M., Lucas, J. A., and Berg, L. J. (2000) A Profound Deficiency in Thymic Progenitor Cells in Mice Lacking Jak3. J Immunol. 165, 3680-3688.

  27. Park, S. Y., Saijo, K., Takahashi, T., Osawa, M., Arase, H., Hirayama, N., Miyake, K., Nakauchi, H., Shirasawa, T., and Saito, T. (1995) Developmental Defects of Lymphoid Cells in Jak3 Kinase-Deficient Mice. Immunity. 3, 771-782.

  28. Baird, A. M., Thomis, D. C., and Berg, L. J. (1998) T Cell Development and Activation in Jak3-Deficient Mice. J Leukoc Biol. 63, 669-677.

  29. Saijo, K., Park, S. Y., Ishida, Y., Arase, H., and Saito, T. (1997) Crucial Role of Jak3 in Negative Selection of Self-Reactive T Cells. J Exp Med. 185, 351-356.

  30. Soldevila, G., Licona, I., Salgado, A., Ramirez, M., Chavez, R., and Garcia-Zepeda, E. (2004) Impaired Chemokine-Induced Migration during T-Cell Development in the Absence of Jak 3. Immunology. 112, 191-200.

  31. Thomis, D. C., Lee, W., and Berg, L. J. (1997) T Cells from Jak3-Deficient Mice have Intact TCR Signaling, but Increased Apoptosis. J Immunol. 159, 4708-4719.

  32. Thomis, D. C., Gurniak, C. B., Tivol, E., Sharpe, A. H., and Berg, L. J. (1995) Defects in B Lymphocyte Maturation and T Lymphocyte Activation in Mice Lacking Jak3. Science. 270, 794-797.

  33. Thomis, D. C., and Berg, L. J. (1997) Peripheral Expression of Jak3 is Required to Maintain T Lymphocyte Function. J Exp Med. 185, 197-206.

  34. Wen, R., Wang, D., McKay, C., Bunting, K. D., Marine, J. C., Vanin, E. F., Zambetti, G. P., Korsmeyer, S. J., Ihle, J. N., and Cleveland, J. L. (2001) Jak3 Selectively Regulates Bax and Bcl-2 Expression to Promote T-Cell Development. Mol Cell Biol. 21, 678-689.

  35. Yagi, R., Zhu, J., and Paul, W. E. (2011) An Updated View on Transcription Factor GATA3-Mediated Regulation of Th1 and Th2 Cell Differentiation. Int Immunol. 23, 415-420.

  36. Seki, Y., Hayashi, K., Matsumoto, A., Seki, N., Tsukada, J., Ransom, J., Naka, T., Kishimoto, T., Yoshimura, A., and Kubo, M. (2002) Expression of the Suppressor of Cytokine Signaling-5 (SOCS5) Negatively Regulates IL-4-Dependent STAT6 Activation and Th2 Differentiation. Proc Natl Acad Sci U S A. 99, 13003-13008.

  37. Shi, M., Lin, T. H., Appell, K. C., and Berg, L. J. (2008) Janus-Kinase-3-Dependent Signals Induce Chromatin Remodeling at the Ifng Locus during T Helper 1 Cell Differentiation. Immunity. 28, 763-773.

  38. Eynon, E. E., Livak, F., Kuida, K., Schatz, D. G., and Flavell, R. A. (1999) Distinct Effects of Jak3 Signaling on Alphabeta and Gammadelta Thymocyte Development. J Immunol. 162, 1448-1459.

  39. Garcia-Zepeda, E. A., Licona-Limon, I., Jimenez-Solomon, M. F., and Soldevila, G. (2007) Janus Kinase 3-Deficient T Lymphocytes have an Intrinsic Defect in CCR7-Mediated Homing to Peripheral Lymphoid Organs. Immunology. 122, 247-260.

  40. Jang, Y. N., Lee, I. J., Park, M. C., and Baik, E. J. (2012) Role of JAK3 in Myogenic Differentiation. Cell Signal. 24, 742-749.

  41. Mishra, J., Waters, C. M., and Kumar, N. (2012) Molecular Mechanism of Interleukin-2-Induced Mucosal Homeostasis. Am J Physiol Cell Physiol. 302, C735-47.

  42. Kumar, N., Mishra, J., Narang, V. S., and Waters, C. M. (2007) Janus Kinase 3 Regulates Interleukin 2-Induced Mucosal Wound Repair through Tyrosine Phosphorylation of Villin. J Biol Chem. 282, 30341-30345.

  43. Tibbles, H. E., Vassilev, A., Wendorf, H., Schonhoff, D., Zhu, D., Lorenz, D., Waurzyniak, B., Liu, X. P., and Uckun, F. M. (2001) Role of a JAK3-Dependent Biochemical Signaling Pathway in Platelet Activation and Aggregation. J Biol Chem. 276, 17815-17822.

  44. Verbsky, J. W., Randolph, D. A., Shornick, L. P., and Chaplin, D. D. (2002) Nonhematopoietic Expression of Janus Kinase 3 is Required for Efficient Recruitment of Th2 Lymphocytes and Eosinophils in OVA-Induced Airway Inflammation. J Immunol. 168, 2475-2482.

  45. Malaviya, R., Navara, C., and Uckun, F. M. (2001) Role of Janus Kinase 3 in Mast Cell-Mediated Innate Immunity Against Gram-Negative Bacteria. Immunity. 15, 313-321.

  46. Wang, H., Brown, J., Gao, S., Liang, S., Jotwani, R., Zhou, H., Suttles, J., Scott, D. A., and Lamont, R. J. (2013) The Role of JAK-3 in Regulating TLR-Mediated Inflammatory Cytokine Production in Innate Immune Cells. J Immunol. 191, 1164-1174.

  47. Rivas-Caicedo, A., Soldevila, G., Fortoul, T. I., Castell-Rodriguez, A., Flores-Romo, L., and Garcia-Zepeda, E. A. (2009) Jak3 is Involved in Dendritic Cell Maturation and CCR7-Dependent Migration. PLoS One. 4, e7066.

  48. Yamaoka, K., Min, B., Zhou, Y. J., Paul, W. E., and O'shea, J. J. (2005) Jak3 Negatively Regulates Dendritic-Cell Cytokine Production and Survival. Blood. 106, 3227-3233.

  49. Ambriz-Pena, X., Garcia-Zepeda, E. A., Meza, I., and Soldevila, G. (2014) Jak3 Enables Chemokine-Dependent Actin Cytoskeleton Reorganization by Regulating Cofilin and Rac/Rhoa GTPases Activation. PLoS One. 9, e88014.

  50. Macchi, P., Villa, A., Giliani, S., Sacco, M. G., Frattini, A., Porta, F., Ugazio, A. G., Johnston, J. A., Candotti, F., and O'Shea, J. J. (1995) Mutations of Jak-3 Gene in Patients with Autosomal Severe Combined Immune Deficiency (SCID). Nature. 377, 65-68.

  51. Russell, S. M., Tayebi, N., Nakajima, H., Riedy, M. C., Roberts, J. L., Aman, M. J., Migone, T. S., Noguchi, M., Markert, M. L., Buckley, R. H., O'Shea, J. J., and Leonard, W. J. (1995) Mutation of Jak3 in a Patient with SCID: Essential Role of Jak3 in Lymphoid Development. Science. 270, 797-800.

  52. Bellanger, D., Jacquemin, V., Chopin, M., Pierron, G., Bernard, O. A., Ghysdael, J., and Stern, M. H. (2014) Recurrent JAK1 and JAK3 Somatic Mutations in T-Cell Prolymphocytic Leukemia. Leukemia. 28, 417-419.

  53. Bergmann, A. K., Schneppenheim, S., Seifert, M., Betts, M. J., Haake, A., Lopez, C., Maria Murga Penas, E., Vater, I., Jayne, S., Dyer, M. J., Schrappe, M., Duhrsen, U., Ammerpohl, O., Russell, R. B., Kuppers, R., Durig, J., and Siebert, R. (2014) Recurrent Mutation of JAK3 in T-Cell Prolymphocytic Leukemia. Genes Chromosomes Cancer. 53, 309-316.

  54. Bouchekioua, A., Scourzic, L., de Wever, O., Zhang, Y., Cervera, P., Aline-Fardin, A., Mercher, T., Gaulard, P., Nyga, R., Jeziorowska, D., Douay, L., Vainchenker, W., Louache, F., Gespach, C., Solary, E., and Coppo, P. (2014) JAK3 Deregulation by Activating Mutations Confers Invasive Growth Advantage in Extranodal Nasal-Type Natural Killer Cell Lymphoma. Leukemia. 28, 338-348.

  55. Bongfen, S. E., Rodrigue-Gervais, I. G., Berghout, J., Torre, S., Cingolani, P., Wiltshire, S. A., Leiva-Torres, G. A., Letourneau, L., Sladek, R., Blanchette, M., Lathrop, M., Behr, M. A., Gruenheid, S., Vidal, S. M., Saleh, M., and Gros, P. (2012) An N-Ethyl-N-Nitrosourea (ENU)-Induced Dominant Negative Mutation in the JAK3 Kinase Protects Against Cerebral Malaria. PLoS One. 7, e31012.

  56. Grossman, W. J., Verbsky, J. W., Yang, L., Berg, L. J., Fields, L. E., Chaplin, D. D., and Ratner, L. (1999) Dysregulated Myelopoiesis in Mice Lacking Jak3. Blood. 94, 932-939.