Phenotypic Mutation 'pongo' (pdf version)
List |< first << previous [record 4 of 16] next >> last >|
Allelepongo
Mutation Type splice acceptor site (15 bp from exon)
Chromosome14
Coordinate103,823,274 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Ednrb
Gene Name endothelin receptor type B
Synonym(s) ETb, ETR-b, Sox10m1
Chromosomal Location 103,814,625-103,844,402 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007904.4, NM_001276296.1, NM_001136061.2; MGI: 102720

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000022718] [ENSMUSP00000126057] [ENSMUSP00000154806]
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably null
Predicted Effect probably null
Phenotypic Category
Phenotypequestion? Literature verified References
digestive/alimentary
growth/size
life span-post-weaning/aging 17246828
pigmentation 17246828
skin/coat/nails 17246828
Penetrance  
Alleles Listed at MGI

All mutations/alleles(48) : Chemically and radiation induced(2) Chemically induced (ENU)(2) Chemically induced (other)(11) Radiation induced(18) Spontaneous(4) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
gus-gus UTSW 14 103820013 missense probably damaging 1.00
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2080:Ednrb UTSW 14 103843100 missense probably damaging 1.00
R2102:Ednrb UTSW 14 103820914 nonsense probably null
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5688:Ednrb UTSW 14 103823395 missense probably damaging 1.00
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R5834:Ednrb UTSW 14 103820877 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository

MMRRC:37598

Last Updated 2018-04-25 3:01 PM by Anne Murray
Record Created 2014-01-30 12:57 PM by Jennifer Weatherly
Record Posted 2014-12-12
Phenotypic Description
Figure 1. The pongo mice (left and center) exhibit pied spotting. A C57BL/6J mouse is shown on the right for reference.

The pongo phenotype was identified among N-ethyl-N-nitrosourea (ENU)-induced G3 mice of the pedigree R0591, some of which had a piebald appearance (i.e., a variable black and white spotting pattern) (Figure 1). Although they appear healthy at birth, the pongo mice die prematurely at or around weaning; cause of death has not been determined.

Nature of Mutation

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations, one of which affected Ednrb, a gene known to cause pied spotting when mutated [(1); see MGI as well as the record for gus-gus]. The Ednrb mutation is a T to A transversion at base pair 103,823,274 (v38) on chromosome 14, or base pair 21,203 in the GenBank genomic region NC_000080 encoding Ednrb. The mutation is located near the acceptor site of intron 2, 15 nucleotides from the next exon. The effect of the mutation at the cDNA and protein levels has not been determined. One possibility, shown below, is that aberrant splicing may result in skipping of the 205 base pair exon 3 (out of 7 total exons), resulting in a frameshift and coding of 19 aberrant amino acids followed by a premature stop codon after amino acid 218.

 

             <--exon 2       <--intron 2 exon 3-->          exon 4-->

21072 ……CTAAGTATTGACAG ……tgtttatatcttcag ATATCGAGCTGTTGCT…… TTTTACAAGA……TCTGCTTGCCGCTAG
195   ……-L--S--I--D--S                   --Y--R--A--V--A-…… --F--T--R-……-S--A--C--R--*  218
          correct                            deleted                 aberrant

 

Genomic numbering corresponds to NC_000080. The acceptor splice site of intron 2, which is destroyed by the mutation is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction

Figure 2. The topography and domain structure of ETBR. (A) ETBR is a G-protein coupled receptor with seven transmembrane (TM) domains. Shown are the locations of the signal peptide and ET-1-induced cleavages of the N-terminus. The post-translational modifications that occur on ETBR are also shown: N-linked glycosyaltion at N60, disulfide bond formation between C174 and C255, palmitoylation at C402, C403, and C405, the 13 phosphorylation (Ps) sites, and the location of Gcoupling. (B) The domain structure of ETBR. The pongo mutation is indicated. The image is interactive. Click to view other Beutler Ednrb alleles. Abbreviations: TM, transmembrane domain; SP, signal peptide; CT, C-terminus, Ps, phosphorylation.

Ednrb encodes endothelin receptor type B (ETBR), a member of the endothelin (ET) receptor family of rhodopsin-like G protein-coupled receptors (GPCRs; see the record for Bemr3) (2;3). The rhodopsin-like GPCRs have seven helical transmembrane domains, three extracellular and three intracellular loops, an extracellular N-terminus, and a cytoplasmic C-terminus (Figure 2). The pongo mutation is predicted to result in coding of a premature stop codon before transmembrane domain 4 of the ETBR.

 

Please see the record gus-gus for more information on Ednrb.

Putative Mechanism

ET-associated signaling (ET-1/ETAR and ET-3/ETBR) is essential for neural crest (NC) cell proliferation, migration, differentiation, and transformation (4-6). The embryonic NC gives rise to pluripotent cells that migrate to different locations within the embryo during development (7). The NC cells subsequently differentiate into several cell types including adrenomedullary cells, craniofacial skeletal tissue, glia and some neurons of the peripheral nervous system, enteric neurons and glia, and melanocytes of the skin, hair and inner ear. ET-3/ETBR-associated signaling is required between embryonic day (E)10-E12.5 in the mouse for the survival and migration of enteric ganglion neurons and melanocytes derived from trunk/vagal NC cells (1;5;6;8-10). Other studies indicate that ETBR signaling may also stimulate melanocyte proliferation in the epidermis (11). Mice homozygous for targeted as well as naturally occurring Ednrb null mutations (e.g., MGI:1856148, MGI:1856149, MGI:1857161, and MGI:3795226) exhibit a piebald appearance due to the absence of NC-derived melanocytes in the epidermis (1;9;12-14). Ednrb null mice also exhibit an absence of choroidal melanocytes; neuroectoderm-derived pigment epithelium melanocytes develop normally (1). Ednrb null mice display early postnatal lethality [from ~postnatal day 15 to up to seven weeks after birth; (1;12;14)]. Similar to spontaneous and targeted Ednrb knockout mouse models, the pongo mice exhibit a piebald appearance and early postnatal lethality. The Ednrb knockout mouse models have established that the observed pigmentation defects are due to the absence of NC-derived melanocytes in the hair bulbs of non-pigmented areas (1;9;12-14).

Primers PCR Primer
pongo(F):5'- GCAAAGTGAACGTACCTGCATGAAG -3'
pongo(R):5'- TTAATCACCGGCACTCAGTGCTC -3'

Sequencing Primer
pongo_seq(F):5'- CATGAAGGCTGTTTTCTGAAAGG -3'
pongo_seq(R):5'- AAGCTGGTGCCCTTCATACAG -3'
Genotyping

Pongo genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Pongo (F): 5’- GCAAAGTGAACGTACCTGCATGAAG-3’

Pongo (R): 5’- TTAATCACCGGCACTCAGTGCTC-3’

 

Sequencing Primer

Pongo (F): 5’- CATGAAGGCTGTTTTCTGAAAGG-3’
 

Pongo (R): 5’- AAGCTGGTGCCCTTCATACAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 535 nucleotides is amplified (Chr.14: 103823040-103823574, GRCm38; NC_000080):

 

gcaaagtgaa cgtacctgca tgaaggctgt tttctgaaag ggattaagca tgcagaccct

taggggcttt cctttgtagt ccgacgtaat catatcaaaa cctatggctt cggggacagc

cagaaccaca gagaccaccc aaattaaaac aatttctact gctgtccatt ttggaacccc

aattccttta attcgactcc aagaagcaac agctcgatat ctgaagatat aaacagaatg

atttgtctag caggtagagc ttggttgtat tgaattgcaa agtttatctc ctaagtgaca

taacagttgt atgttggatt aggatcgcct tggcctgaga atagactctt acctgtcaat

acttagagca caaagactca gcactgtgat tcccacagaa gccttctgta tgaagggcac

cagcttacac atctcagctc caaatggcca gtcctctgcg agcaactgca tagaggaaac

gggaaggtcg gttacggaga tttttctgag ctgagcactg agtgccggtg attaa

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide (A) is shown in red text (Chr. + strand, A>T; sense strand, T>A).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsCarlos Reyna Tiana Purrington
List |< first << previous [record 4 of 16] next >> last >|