Phenotypic Mutation 'Frozen'

• Allele: Frozen
• Mutation Type: splice site (5 bp from exon)
• Chromosome: 8
• Coordinate: 10,081,661 bp (GRCm39)
• Base Change: G ⇒ A (forward strand)
• Gene: Tnfsf13b
• Gene Name: tumor necrosis factor (ligand) superfamily, member 13b
• Synonym(s): BLyS, TALL-1, zTNF4, D8Ertd387e, BAFF
• Chromosomal Location: 10,056,229-10,086,000 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011] ; PHENOTYPE: Homozygous null mice have reduced number of B cells and reduced levels of immunoglobulins. [provided by MGI curators]
• Mapped: Yes
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000033892 ^†] [ENSMUSP00000146694 ^†] [ENSMUSP00000146904 ^†] † probably from a misspliced transcript
• AlphaFold: Q9WU72
• SMART Domains: Protein: ENSMUSP00000033892; Gene: ENSMUSG00000031497

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
TNF	169	308	1.88e-2	SMART

• Predicted Effect: probably null
• SMART Domains: Protein: ENSMUSP00000033892; Gene: ENSMUSG00000031497

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
TNF	169	308	1.88e-2	SMART

• Predicted Effect: probably null
• Predicted Effect: probably null
• Predicted Effect: probably null
• Predicted Effect: probably benign
• Meta Mutation Damage Score: 0.9755
• Is this an essential gene?: Probably nonessential (E-score: 0.081)
• Phenotypic Category: Autosomal Semidominant
• Mode of Inheritance: Autosomal Semidominant
• Local Stock: Live Mice
• MMRRC Submission: 038182-MU
• Last Updated: 2019-09-04 9:49 PM by Diantha La Vine
• Record Created: 2014-05-15 1:38 PM by Kuan-Wen Wang
• Record Posted: 2015-06-20
• Science Writers: Anne Murray
• Illustrators: Peter Jurek
• Authors: Bruce Beutler, Jin Huk Choi, Kuan-Wen Wang, Ming Zeng

Accession Number

NCBI RefSeq: NM_033622; MGI:1344376

Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Targeted(5) Transgenic(1)

Phenotypic Description

Figure 1. Frozen mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Frozen mice exhibit decreased frequencies of peripheral IgM + B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM + B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Frozen mice exhibit decreased percentages of peripheral IgD + B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD + B cell percentages. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Frozen mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Frozen mice exhibit increased frequencies of peripheral CD8 + T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Frozen mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Frozen mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Frozen phenotype was identified among N-ethyl-N-nitrosourea  (ENU)-mutagenized G3 mice of the pedigree R0610, some of which showed a reduced frequency of B cells (Figure 1), a reduced frequency of IgM⁺ B cells (Figure 2), a decreased percentage of IgD⁺ B cells (Figure 3), an increased frequency of T cells (Figure 4), and an increased frequency of CD8⁺ T cells (Figure 5), all in the peripheral blood. Some mice also had a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 6). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also reduced (Figure 7). 

Nature of Mutation

Figure 8. Linkage mapping of the reduced peripheral IgM + B cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 96 mutations (X-axis) identified in the G1 male of pedigree R0610. Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. All of the above phenotypic anomalies were linked by continuous variable mapping to a mutation in Tnfsf13b: a T to A transversion at base pair 10,031,661 (v38) on chromosome 8, or base pair 25,469 in the GenBank genomic region NC_000074 within the donor splice site of intron 6. The strongest association was found with an additive model of linkage to the normalized frequency of peripheral IgM⁺ B cells, wherein 10 variant homozygotes and 19 heterozygotes departed phenotypically from 15 homozygous reference mice with a P value of 1.00 x 10^-17 (Figure 8).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 151-nucleotide exon 6 (out of 7 total exons), a frame-shift that results in coding of 34 aberrant amino acids followed by a premature stop codon.

<--exon 5         <--exon 6 intron 6-->       exon 7--> 25216 ……TTCATCTACAGCCAG……TCCTGCTACTCGGCTG gtatgtagctgtcct…… GCATCGCGAGGCTGG……TCTTTGGTGCCCTAA 218   ……-F--I--Y--S--Q-……-S--C--Y--S--A--                   -A--S--R--G--W-……-S--L--V--P--* correct deleted aberrant

Genomic numbering corresponds to NC_000074. The donor splice site of intron 6, which is destroyed by the frozen mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 9. Domain structure of BAFF. BAFF is a type II transmembrane protein. BAFF is cleaved by furin-like proteases between Arg126 and Ala127 to produce soluble BAFF (sBAFF). The Frozen mutation destroys the donor splice site of intron 6.This image is interactive. Click on each allele. Abbreviations: TM, transmembrane domain; THD, TNF homology domain. See the text for more details.

Tnfsf13b encodes B cell activating factor (BAFF; alternatively, BLyS, TALL-1, zTNF-4, THANK, or TNFSF13), a member of the tumor necrosis factor (TNF) family (Figure 9). BAFF is a type II transmembrane protein that undergoes cleavage between Arg126 and Ala127 by furin-like proteases to generate a soluble form of BAFF (sBAFF) (1-3). Both the full-length and soluble forms of BAFF are biologically active (1;2). The full-length form of BAFF is proposed to function in the maintenance of peripheral B2 B cells, mediate the production of basal levels of IgA, and regulate the differentiation of marginal zone B cells (4). The soluble form of BAFF is essential for B cell development and T-independent type 2 humoral responses (4).

The extracellular TNF homology domain (THD) of BAFF (amino acids 169-308) mediates binding to the BAFF receptor [BAFFR; alternatively, BR3 (BLyS receptor 3)] and shows highest shared identity with APRIL (a proliferation-inducing ligand; 33% amino acid identity, 48% homology), another member of the TNF family, and lesser identity (<20%) with TNF family proteins TNFα (see the record for Panr1), TRAIL (TNF-related apoptosis-inducing ligand), RANKL (receptor activator of NF-κB ligand), and LT-α (lymphotoxin-α; see the record for kama) [(1;5;6); reviewed in (7)].

Figure 10. Model of a soluble human BAFF trimer. UCSF Chimera model is based on PDB: 1JH5. Click on the image to view the structure rotate.

Figure 11. Model of the human BAFF-BAFF receptor interaction. The soluble form of BAFF and the extracellular domain of the BAFFR are modeled. UCSF Chimera model is based on PDB: IOQE. Click on the image to view the structure rotate.

At low pH, the sBAFF monomer consists of two layers of anti-parallel β-strands that fold into a jellyroll-like β-sandwich topology similar to other TNF family ligands [Figure 10; PDB:1JH5; (8-15)]. Two unique features in sBAFF to other TNF ligands is the presence of an elbow region containing a short β-hairpin and a flap region (9). Soluble BAFF is active as a trimer. The trimer interface is comprised mainly of layered aromatic residues including Phe194, Tyr196, and Tyr246 (numbering corresponds to the human BAFF protein) from three BAFF monomers (9). Gln144 from each of the three monomers forms a hydrogen bond net and Leu285 from each monomer also forms an interaction layer (9). The flap region mediates trimer-trimer interactions. Tyr192, Lys252, Glu254, and His218 from two monomers interact to form layer 1 of the trimer interace. A second layer is composed of Lys216, Glu223, Leu224, Val227, and Leu229 from each monomer. At neutral or basic pH, sBAFF trimers assemble into a 60-mer virus-like cluster (9). The physiological importance of the cluster formation is not known. Coexpression of human sBAFF with either BCMA (B cell maturation antigen) or BAFFR, in solution generates the virus-like cluster [Figure 11; PDB: 1OQE; (15)]. sBAFF and BCMA interact at a one-to-one ratio (15). Eight residues in the primary sBAFF (Tyr163, Tyr206, Leu211, Arg231, Ile233, Pro264, Arg265 and Glu266; human protein sequence numbering) and four from the secondary sBAFF ligand (Leu200, Leu240, Asp273 and Asp275) interact with nine residues in BCMA (Tyr13, Asp15, Leu17, Leu18, His19, Ile22, Leu26, Arg27 and Pro34) (15). The interaction of BAFF with the BAFFR is mediated by Tyr163, Asp203, Tyr206, Leu211, Arg231, Ile233, Pro264, Arg265, Glu266 and Asn267 from the primary sBAFF as well as Leu200, Leu240, Asp273 and Asp275, and Asp222 from a neighboring sBAFF trimer (15).

Mouse Tnfsf13b can undergo alternative splicing that results in skipping of exon 4 (exon 4 encodes the first β-sheet of the THD (amino acids 156-184); Gly185 is substituted with an Arg) and creation of a functional N-linked glycosylation site at Asn155 to produce a splice variant called ΔBAFF [(8); reviewed in (7)]. The ΔBAFF isoform is able to assemble into disulfide-linked complexes with itself as well as full-length BAFF (8). Association of ΔBAFF with BAFF prevents release of sBAFF and results in formation of inactive homotrimers (8;16). The ΔBAFF variant is expressed in all myeloid cell lines examined as well as in bone marrow-derived macrophages (8). Transgenic mice expressing ΔBAFF in myeloid and dendritic cells exhibited reduced follicular and marginal zone B cell numbers and diminished T-dependent humoral responses; the T cell-independent response was not affected (16). The frequency of Th17 cells was increased in the BAFF-Tg mice (17).

The Frozen mutation is predicted to alter the sequence of the THD. Alteration of the THD may result in aberrant association of BAFF^Frozen with its receptors and/or the formation of inactive homotrimers.

Expression/Localization

Tnfsf13b is expressed in peripheral blood mononuclear cells, spleen, lymph node, and bone marrow as well as at lower levels in placenta, fetal liver, heart, lung, thymus, small intestine, and pancreas (1;2;6;18;19). The BAFF protein is expressed in monocytes, macrophages, dendritic cells, neutrophils, some subpopulations of B and T cells, stromal cells, malignant B cells, epithelial cells, adipocytes, the brain, and astrocytes (1-3;6;20-24). 

BAFF expression is upregulated by several cytokines including IFN-α (see the record for macro-1), IFN-γ, and IL-10 as well as by growth factors and estrogen (20;21;25). BAFF expression is upregulated by TLR4 (see the record for lps3) and TLR9 (see the record for Cpg1) signaling (19). BAFF expression in germinal center B cells was induced upon immunization with the T-dependent antigen 2-phenyl-oxazolone (19). Reactive oxygen species generated by serum deprivation also increased BAFF expression, while antioxidants and nitric oxide inhibited BAFF expression (26;27). Estrogen-mediated regulation of Tnfsf13b resulted in higher steady-state expression in CD11b⁺, CD11c⁺, and CD19⁺ cells in female mice compared to that in male mice.

Background

Figure 12. BAFF in B-Cell Signaling. BAFF binds to three receptors BCMA, TACI, and BAFFR. BCMA can activate NF-κB through TRAF5 (TNF Receptor-Associated Factor-5), TRAF6, TRAF3, NIK (NF-KappaB Inducing Kinase), and IKK (I-KappaB Kinase)-dependent pathway. Engagement of BCMA also activates JNK (Jun N-terminal Kinases), p38 MAPK (Mitogen Activated Protein Kinase) and the transcription factor Elk1. The intracellular domain of TACI associates with TRAFs and activates NF-κB, NFAT (Nuclear Factor of Activated T-Cells) and JNK. The binding of BAFF to BAFFR is primarily responsible for supporting transitional B-Cell maturation and enhancing the survival of mature B-Cells. See the text for more details. Some of the protein images are modeled after crystal structures: p38 and ERK2, PDB:1LEZ; SEK1/MKK4, PDB: 3ALN; MKK7, PDB:3WZU; JNK, PDB:1JNK; BCMA, PDB:1XU2; TACI, PDB:1XUT; TRAF1:TRAF2:cIAP2, PDB:3M0D; TRAF6, PDB:1LB5; BAFFR, PDB:1OQE; MAP2K7, PDB:3WZU, NFAT, PDB:2JOG; TAK1, PDB:3A9K; TRAF2, PDB:2X7F.

BAFF can bind to three TNF receptor family members: BCMA, TACI (transmembrane activator and calcium modulator ligand (CAML) interactor), and BAFFR [Figure 12; (28;29); reviewed in (30)]. BCMA is expressed on B cells and is dispensable for early B cell differentiation, but functions in long-term maintenance of bone marrow plasma cells (31). BAFF- or APRIL-mediated activation of BCMA is sufficient to support plasma cell survival (32). TACI is expressed on mature follicular, marginal zone, T2, and T3 transitional B cells as well as on activated T cells (33). TACI is proposed to be a negative regulator B cells (33;34), but promotes IgA class switching (35). TACI-deficient mice have a higher number of follicular and marginal zone B cells, but the ratio of maturing B cell subsets in the spleen is normal (33). In addition, TACI-deficient mice have reduced T cell-independent antibody responses (33).

BAFFR is expressed on mature follicular and marginal zone B cells as well as on T2 and T3 transitional B cells, plasma cells, and plasmablasts (29;36). BAFF/BAFFR signaling is essential for B cell homeostasis, differentiation, proliferation, survival, and function (1;2;19;37;38). Proliferation of anti-IgM-stimulated peripheral B cells is induced by both membrane-bound and sBAFF (1). BAFF also functions in the induction of IL-10-producing regulatory B cell (CD1d^hiCD5⁺) differentiation from marginal zone B cells that suppress T cell proliferation and Th1 cytokine production (39). BAFF/BAFFR activates the alternative NF-κB (NF-κB2) signaling pathway (see the record for xander) to mediate the survival and maturation of splenic B cells (40;41). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (42;43). TRAF2 and TRAF5 positively regulate NIK activity under certain conditions (44), but in other contexts, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (45-48). After stimulation with BAFFR, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (46-48). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (49-51). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (50). BAFF/BAFFR-induced NF-κB2 signaling promotes B cell survival by upregulating integrins that retains autoreactive B cells in the splenic marginal zone (52). In addition, ERK activation is sustained and there is an increased turnover of Bim, a proapoptotic protein (40;41;53). BAFF activates the classical NF-κB (NF-κB1) signaling pathway (see the record for Finlay) to regulate immunoglobulin class switching through an induction of activation induced deaminase (AID) and to generate antibodies (52).

BAFF also induces the protein kinase Cδ (PKCδ) and Akt/mTOR signaling pathways to regulate B-cell survival (53-56). PKCδ functions in regulating apoptotic cell death [reviewed in (57)]. The tyrosine kinase c-Abl phosphorylates PKCδ in response to genotoxic and oxidative stress (58;59). PKCδ phosphorylation activates the protein and facilitates the translocation of PKCδ to the nucleus. Within the nucleus, PKCδ phosphorylates histone H2B and subsequently regulates peripheral B cell death (54). BAFF prevents the nuclear accumulation of PKCδ. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. BAFF binding to the BAFFR activates phosphoinositide 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt (60). BAFF-stimulated activation of mTOR leads to subsequent phosphorylation of mTOR targets p70 S6 kinase and the translational inhibitor 4E-BP1 as well as the activation of Akt targets forkhead transcription factors FOXO3a and FOXO1 [reviewed in (30)].

TLR-associated signaling can regulate BAFF secretion and subsequent signaling. TLR2, TLR4, and TLR9 activation stimulates myeloid dendritic cells and macrophages to secrete BAFF, which subsequently promotes BCR- and CD40-induced B cell proliferation (21;61;62) and class switch recombination (35). B cells activated with both LPS (the TLR4 ligand) and BAFF/BAFFR are protected from spontaneous apoptosis, but are more susceptible to Fas (see the record for cherry)-mediated cell death due to an upregulation of MEK/ERK-associated Fas and IRF-4 expression (61). The BAFF-induced upregulation of Fas is restricted to TLR4-activated B cells, but not B cells activated by TLR9, the B cell receptor, or CD40 (61).

BAFF has additional functions outside of B cell regulation. BAFF is proposed to be an adipokine that links obesity and inflammation (23;24). BAFF expression is increased in adipocytes during adipocyte differentiation as well as during TNF-α treatment (23;63). In 3T3-L1 adipocytes BAFF decreased expression of the adipokines leptin (see the record for Potbelly) and adiponectin, but increased the expression of the proinflammatory adipokines monocyte chemotactic protein-1 (CCL2), interleukin-6 (IL-6), cyclooxygenase-2 (COX-2) and haptoglobin (64). Kim et al. propose that BAFF not only regulates adipokine expression, but also mediates adipocyte and macrophage interaction (64). BAFF also functions as a neurotrophic factor to regulate neural cell survival (65). In an animal model of inherited amyotrophic lateral sclerosis, BAFFR-associated signaling was impaired. Loss of BAFFR expression in B cells or in bone marrow cells did not alter disease progress indicting that it is the BAFF-mediated signals on neurons that support neural cell survival (65). In the brains of patients with multiple sclerosis, BAFF promotes survival of BAFFR-expressing B cells, allowing for the clonal expansion of B cells in the central nervous system (22;66).

Elevated circulating levels of BAFF have been observed in several human pathological conditions including rheumatoid arthritis (RA), multiple sclerosis, systemic lupus erythematosus (SLE), and Sjögren's syndrome (SS). BAFF can also form heterotrimers with APRIL (67;68). Increased levels of BAFF/APRIL heterotrimers have been noted in the serum of patients with autoimmune diseases (68). Tnfsf13b silencing using a lentivirus expressing Tnfsf13b shRNA resulted in long-term suppression of arthritis development in a collagen-induced arthritis model (69). BAFF promotes the expansion of Th17 cells and IL-17 is a major effector cytokine for the BAFF-mediated proinflammatory effects observed in arthritis (69). Inhibition of BAFF expression resulted in reduced proinflammatory cytokine expression as well as reduced generation of plasma cells and Th17 cells.  In a murine model of collagen-induced arthritis, macrophages and dendritic cells produced elevated amounts of BAFF; increased levels of BAFF secreted by DCs occurred at the early stage of arthritis development, while macrophage BAFF secretion correlated with later stages of arthritis (67). In addition, DC-secreted BAFF resulted in increased peripheral B cell proliferation and survival. In multiple sclerosis, high levels of BAFF result in dysregulation of T cell survival and apoptosis. BAFF blockade with TACI-IgG reduced T cell survival in myelin oligodendroglia glycoprotein (MOG)-induced chronic experimental allergic encephalitis (EAE) (70). In addition, BAFF expression induced Bcl2 expression and subsequent apoptosis in T cells by upregulating osteopontin (OPN) secretion from B cells via NF-κB signaling (70). BAFF facilitates the survival of both malignant (e.g., multiple myelomas, lymphomas and non Hodgkin's leukemias) and autoreactive B cells (71-74).

Putative Mechanism

Several mouse models were developed to study the function of BAFF. Early B cell development in the bone marrow of BAFF-deficient (Tnfsf13b^-/-) mice is normal (1); however, B cell maturation is impaired beyond the immature transitional type 1 (T1; CD21/35⁻CD23⁻) stage (5;38;75). Therefore, more than 90% of mature B cells including transitional T2 (CD21/35^highCD23⁺), mature follicular (IgM^dullIgD^hiCD21/35^lowCD23⁺), and marginal zone B cells (IgM^hiIgD⁻CD21/35^highCD23⁻) are lost (5;75;76). The percentage of peripheral B1 B cells in the Tnfsf13b^-/- mice was comparable to that in wild-type mice; however, the B2 (B220⁺, CD23^hi) B cell percentage in the periphery was reduced compared to wild-type mice (75-77). The numbers of thymocyte populations (i.e., CD4 and CD8 T cells) and CD3⁺ peripheral T cells in the spleen and lymph nodes were comparable between the Tnfsf13b^-/- and wild-type mice (75;76). However, the numbers of CD44⁺CD62L⁻ memory/effector T cells were reduced in the Tnfsf13b^-/- mice compared to those in wild-type mice (76). The Tnfsf13b^-/- mice exhibit reduced levels of serum IgG and IgM compared to those in wild-type mice (75;76). IgA was only moderately reduced (75). The T-dependent and T-independent humoral responses were diminished in the Tnfsf13b^-/- mice due to loss of BAFF-regulated terminal plasmablast differentiation and/or IgM secretion (5;75;76;78-80). Mice that overexpress BAFF (BAFF-Tg) exhibit increased mature B cells in the periphery, spontaneous germinal center reactions, enlarged lymphoid organs and spleens, anti-DNA antibodies, proteinuria, hypergammaglobulinemia, and glomerulonephritis (75;81;82). Together, these phenotypes are similar to SLE and SS in humans (83;84). The BAFF-Tg mice have mesangial deposits of IgA with a concomitant increase in circulating polymeric IgA (83;85). The renal disease exhibited by the BAFF-Tg mice was due to the elevation in serum IgA (83). Th17 cells were increased in the BAFF-Tg mice (17). In addition, the levels of circulating Ig is increased in transgenic mice overexpressing BAFF (73;82;84). The phenotypes observed of the Frozen mice are similar to the Tnfsf13b^-/- mice (1), indicating that, if expressed, BAFF^Frozen exhibits loss of function.

Primers

PCR Primer
Frozen_pcr_F: CTATACACGGACCCCATCTTTGCTATG
Frozen_pcr_R: TGCTCCAATGTCAAATTCTGTGACCC

Sequencing Primer
Frozen_seq_F: CTATGGGTCATGTCATCCAGAG
Frozen_seq_R: actgcctctccatcccc

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 631 nucleotides is amplified (chromosome 8, + strand):

1   ctatacacgg accccatctt tgctatgggt catgtcatcc agaggaagaa agtacacgtc
61  tttggggacg agctgagcct ggtgaccctg ttccgatgta ttcagaatat gcccaaaaca
121 ctgcccaaca attcctgcta ctcggctggt atgtagctgt cctaagacct gcttagcaag
181 atggtgtaga ttgtgctggg gaatcttatt ccccccaaaa gtgctgcttt gggatcttaa
241 tggaaagacc ttctgccata gactgtgctg tttattttac aataatttgt gttgacggag
301 aaaactgata tcattactaa tagtcatacc atttttataa aaattaagac agagatgggg
361 atggagaggc agtctcataa tgaagaacac tggctgctct tccagagaac ctcagcttca
421 tttccagcac ccacatggca gcgcacaact ctctgtacct ctagtcccaa gggacctggc
481 actctcttat ggcctccttg ggccctgcac atacatagtg cacataaaga tacgcaggaa
541 aaataccaat acacagaaaa aaataattac attaaataaa tgtgctttta aaaagttaaa
601 aatgagggtc acagaatttg acattggagc a

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Schneider, P., MacKay, F., Steiner, V., Hofmann, K., Bodmer, J. L., Holler, N., Ambrose, C., Lawton, P., Bixler, S., Acha-Orbea, H., Valmori, D., Romero, P., Werner-Favre, C., Zubler, R. H., Browning, J. L., and Tschopp, J. (1999) BAFF, a Novel Ligand of the Tumor Necrosis Factor Family, Stimulates B Cell Growth. J Exp Med. 189, 1747-1756.

  2. Moore, P. A., Belvedere, O., Orr, A., Pieri, K., LaFleur, D. W., Feng, P., Soppet, D., Charters, M., Gentz, R., Parmelee, D., Li, Y., Galperina, O., Giri, J., Roschke, V., Nardelli, B., Carrell, J., Sosnovtseva, S., Greenfield, W., Ruben, S. M., Olsen, H. S., Fikes, J., and Hilbert, D. M. (1999) BLyS: Member of the Tumor Necrosis Factor Family and B Lymphocyte Stimulator. Science. 285, 260-263.

  3. Tribouley, C., Wallroth, M., Chan, V., Paliard, X., Fang, E., Lamson, G., Pot, D., Escobedo, J., and Williams, L. T. (1999) Characterization of a New Member of the TNF Family Expressed on Antigen Presenting Cells. Biol Chem. 380, 1443-1447.

  4. Bossen, C., Tardivel, A., Willen, L., Fletcher, C. A., Perroud, M., Beermann, F., Rolink, A. G., Scott, M. L., Mackay, F., and Schneider, P. (2011) Mutation of the BAFF Furin Cleavage Site Impairs B-Cell Homeostasis and Antibody Responses. Eur J Immunol. 41, 787-797.

  5. Do, R. K., and Chen-Kiang, S. (2002) Mechanism of BLyS Action in B Cell Immunity. Cytokine Growth Factor Rev. 13, 19-25.

  6. Shu, H. B., Hu, W. H., and Johnson, H. (1999) TALL-1 is a Novel Member of the TNF Family that is Down-Regulated by Mitogens. J Leukoc Biol. 65, 680-683.

  7. Bossen, C., and Schneider, P. (2006) BAFF, APRIL and their Receptors: Structure, Function and Signaling. Semin Immunol. 18, 263-275.

  8. Gavin, A. L., Ait-Azzouzene, D., Ware, C. F., and Nemazee, D. (2003) DeltaBAFF, an Alternate Splice Isoform that Regulates Receptor Binding and Biopresentation of the B Cell Survival Cytokine, BAFF. J Biol Chem. 278, 38220-38228.

  9. Liu, Y., Xu, L., Opalka, N., Kappler, J., Shu, H. B., and Zhang, G. (2002) Crystal Structure of sTALL-1 Reveals a Virus-Like Assembly of TNF Family Ligands. Cell. 108, 383-394.

  10. Eck, M. J., and Sprang, S. R. (1989) The Structure of Tumor Necrosis Factor-Alpha at 2.6 A Resolution. Implications for Receptor Binding. J Biol Chem. 264, 17595-17605.

  11. Eck, M. J., Ultsch, M., Rinderknecht, E., de Vos, A. M., and Sprang, S. R. (1992) The Structure of Human Lymphotoxin (Tumor Necrosis Factor-Beta) at 1.9-A Resolution. J Biol Chem. 267, 2119-2122.

  12. Karpusas, M., Hsu, Y. M., Wang, J. H., Thompson, J., Lederman, S., Chess, L., and Thomas, D. (1995) 2 A Crystal Structure of an Extracellular Fragment of Human CD40 Ligand. Structure. 3, 1031-1039.

  13. Cha, S. S., Kim, M. S., Choi, Y. H., Sung, B. J., Shin, N. K., Shin, H. C., Sung, Y. C., and Oh, B. H. (1999) 2.8 A Resolution Crystal Structure of Human TRAIL, a Cytokine with Selective Antitumor Activity. Immunity. 11, 253-261.

  14. Lam, J., Nelson, C. A., Ross, F. P., Teitelbaum, S. L., and Fremont, D. H. (2001) Crystal Structure of the TRANCE/RANKL Cytokine Reveals Determinants of Receptor-Ligand Specificity. J Clin Invest. 108, 971-979.

  15. Liu, Y., Hong, X., Kappler, J., Jiang, L., Zhang, R., Xu, L., Pan, C. H., Martin, W. E., Murphy, R. C., Shu, H. B., Dai, S., and Zhang, G. (2003) Ligand-Receptor Binding Revealed by the TNF Family Member TALL-1. Nature. 423, 49-56.

  16. Gavin, A. L., Duong, B., Skog, P., Ait-Azzouzene, D., Greaves, D. R., Scott, M. L., and Nemazee, D. (2005) DeltaBAFF, a Splice Isoform of BAFF, Opposes Full-Length BAFF Activity in Vivo in Transgenic Mouse Models. J Immunol. 175, 319-328.

  17. Zhou, X., Xia, Z., Lan, Q., Wang, J., Su, W., Han, Y. P., Fan, H., Liu, Z., Stohl, W., and Zheng, S. G. (2011) BAFF Promotes Th17 Cells and Aggravates Experimental Autoimmune Encephalomyelitis. PLoS One. 6, e23629.

  18. Mukhopadhyay, A., Ni, J., Zhai, Y., Yu, G. L., and Aggarwal, B. B. (1999) Identification and Characterization of a Novel Cytokine, THANK, a TNF Homologue that Activates Apoptosis, Nuclear Factor-kappaB, and c-Jun NH2-Terminal Kinase. J Biol Chem. 274, 15978-15981.

  19. Chu, V. T., Enghard, P., Riemekasten, G., and Berek, C. (2007) In Vitro and in Vivo Activation Induces BAFF and APRIL Expression in B Cells. J Immunol. 179, 5947-5957.

  20. Scapini, P., Nardelli, B., Nadali, G., Calzetti, F., Pizzolo, G., Montecucco, C., and Cassatella, M. A. (2003) G-CSF-Stimulated Neutrophils are a Prominent Source of Functional BLyS. J Exp Med. 197, 297-302.

  21. Nardelli, B., Belvedere, O., Roschke, V., Moore, P. A., Olsen, H. S., Migone, T. S., Sosnovtseva, S., Carrell, J. A., Feng, P., Giri, J. G., and Hilbert, D. M. (2001) Synthesis and Release of B-Lymphocyte Stimulator from Myeloid Cells. Blood. 97, 198-204.

  22. Krumbholz, M., Theil, D., Derfuss, T., Rosenwald, A., Schrader, F., Monoranu, C. M., Kalled, S. L., Hess, D. M., Serafini, B., Aloisi, F., Wekerle, H., Hohlfeld, R., and Meinl, E. (2005) BAFF is Produced by Astrocytes and Up-Regulated in Multiple Sclerosis Lesions and Primary Central Nervous System Lymphoma. J Exp Med. 201, 195-200.

  23. Kim, Y. H., Choi, B. H., Cheon, H. G., and Do, M. S. (2009) B Cell Activation Factor (BAFF) is a Novel Adipokine that Links Obesity and Inflammation. Exp Mol Med. 41, 208-216.

  24. Alexaki, V. I., Notas, G., Pelekanou, V., Kampa, M., Valkanou, M., Theodoropoulos, P., Stathopoulos, E. N., Tsapis, A., and Castanas, E. (2009) Adipocytes as Immune Cells: Differential Expression of TWEAK, BAFF, and APRIL and their Receptors (Fn14, BAFF-R, TACI, and BCMA) at Different Stages of Normal and Pathological Adipose Tissue Development. J Immunol. 183, 5948-5956.

  25. Panchanathan, R., and Choubey, D. (2013) Murine BAFF Expression is Up-Regulated by Estrogen and Interferons: Implications for Sex Bias in the Development of Autoimmunity. Mol Immunol. 53, 15-23.

  26. Moon, E. Y., Lee, J. H., Oh, S. Y., Ryu, S. K., Kim, H. M., Kwak, H. S., and Yoon, W. K. (2006) Reactive Oxygen Species Augment B-Cell-Activating Factor Expression. Free Radic Biol Med. 40, 2103-2111.

  27. Giordano, D., Draves, K. E., Li, C., Hohl, T. M., and Clark, E. A. (2014) Nitric Oxide Regulates BAFF Expression and T Cell-Independent Antibody Responses. J Immunol. 193, 1110-1120.

  28. Gross, J. A., Johnston, J., Mudri, S., Enselman, R., Dillon, S. R., Madden, K., Xu, W., Parrish-Novak, J., Foster, D., Lofton-Day, C., Moore, M., Littau, A., Grossman, A., Haugen, H., Foley, K., Blumberg, H., Harrison, K., Kindsvogel, W., and Clegg, C. H. (2000) TACI and BCMA are Receptors for a TNF Homologue Implicated in B-Cell Autoimmune Disease. Nature. 404, 995-999.

  29. Thompson, J. S., Bixler, S. A., Qian, F., Vora, K., Scott, M. L., Cachero, T. G., Hession, C., Schneider, P., Sizing, I. D., Mullen, C., Strauch, K., Zafari, M., Benjamin, C. D., Tschopp, J., Browning, J. L., and Ambrose, C. (2001) BAFF-R, a Newly Identified TNF Receptor that Specifically Interacts with BAFF. Science. 293, 2108-2111.

  30. Woodland, R. T., Schmidt, M. R., and Thompson, C. B. (2006) BLyS and B Cell Homeostasis. Semin Immunol. 18, 318-326.

  31. O'Connor, B. P., Raman, V. S., Erickson, L. D., Cook, W. J., Weaver, L. K., Ahonen, C., Lin, L. L., Mantchev, G. T., Bram, R. J., and Noelle, R. J. (2004) BCMA is Essential for the Survival of Long-Lived Bone Marrow Plasma Cells. J Exp Med. 199, 91-98.

  32. Benson, M. J., Dillon, S. R., Castigli, E., Geha, R. S., Xu, S., Lam, K. P., and Noelle, R. J. (2008) Cutting Edge: The Dependence of Plasma Cells and Independence of Memory B Cells on BAFF and APRIL. J Immunol. 180, 3655-3659.

  33. von Bulow, G. U., van Deursen, J. M., and Bram, R. J. (2001) Regulation of the T-Independent Humoral Response by TACI. Immunity. 14, 573-582.

  34. Seshasayee, D., Valdez, P., Yan, M., Dixit, V. M., Tumas, D., and Grewal, I. S. (2003) Loss of TACI Causes Fatal Lymphoproliferation and Autoimmunity, Establishing TACI as an Inhibitory BLyS Receptor. Immunity. 18, 279-288.

  35. Litinskiy, M. B., Nardelli, B., Hilbert, D. M., He, B., Schaffer, A., Casali, P., and Cerutti, A. (2002) DCs Induce CD40-Independent Immunoglobulin Class Switching through BLyS and APRIL. Nat Immunol. 3, 822-829.

  36. Shulga-Morskaya, S., Dobles, M., Walsh, M. E., Ng, L. G., MacKay, F., Rao, S. P., Kalled, S. L., and Scott, M. L. (2004) B Cell-Activating Factor Belonging to the TNF Family Acts through Separate Receptors to Support B Cell Survival and T Cell-Independent Antibody Formation. J Immunol. 173, 2331-2341.

  37. Hsu, B. L., Harless, S. M., Lindsley, R. C., Hilbert, D. M., and Cancro, M. P. (2002) Cutting Edge: BLyS Enables Survival of Transitional and Mature B Cells through Distinct Mediators. J Immunol. 168, 5993-5996.

  38. Batten, M., Groom, J., Cachero, T. G., Qian, F., Schneider, P., Tschopp, J., Browning, J. L., and Mackay, F. (2000) BAFF Mediates Survival of Peripheral Immature B Lymphocytes. J Exp Med. 192, 1453-1466.

  39. Yang, M., Sun, L., Wang, S., Ko, K. H., Xu, H., Zheng, B. J., Cao, X., and Lu, L. (2010) Novel Function of B Cell-Activating Factor in the Induction of IL-10-Producing Regulatory B Cells. J Immunol. 184, 3321-3325.

  40. Claudio, E., Brown, K., Park, S., Wang, H., and Siebenlist, U. (2002) BAFF-Induced NEMO-Independent Processing of NF-Kappa B2 in Maturing B Cells. Nat Immunol. 3, 958-965.

  41. Kayagaki, N., Yan, M., Seshasayee, D., Wang, H., Lee, W., French, D. M., Grewal, I. S., Cochran, A. G., Gordon, N. C., Yin, J., Starovasnik, M. A., and Dixit, V. M. (2002) BAFF/BLyS Receptor 3 Binds the B Cell Survival Factor BAFF Ligand through a Discrete Surface Loop and Promotes Processing of NF-kappaB2. Immunity. 17, 515-524.

  42. Vallabhapurapu, S., and Karin, M. (2009) Regulation and Function of NF-kappaB Transcription Factors in the Immune System. Annu Rev Immunol. 27, 693-733.

  43. Senftleben, U., Cao, Y., Xiao, G., Greten, F. R., Krahn, G., Bonizzi, G., Chen, Y., Hu, Y., Fong, A., Sun, S. C., and Karin, M. (2001) Activation by IKKalpha of a Second, Evolutionary Conserved, NF-Kappa B Signaling Pathway. Science. 293, 1495-1499.

  44. Song, H. Y., Regnier, C. H., Kirschning, C. J., Goeddel, D. V., and Rothe, M. (1997) Tumor Necrosis Factor (TNF)-Mediated Kinase Cascades: Bifurcation of Nuclear Factor-kappaB and c-Jun N-Terminal Kinase (JNK/SAPK) Pathways at TNF Receptor-Associated Factor 2. Proc Natl Acad Sci U S A. 94, 9792-9796.

  45. Liao, G., Zhang, M., Harhaj, E. W., and Sun, S. C. (2004) Regulation of the NF-kappaB-Inducing Kinase by Tumor Necrosis Factor Receptor-Associated Factor 3-Induced Degradation. J Biol Chem. 279, 26243-26250.

  46. Vallabhapurapu, S., Matsuzawa, A., Zhang, W., Tseng, P. H., Keats, J. J., Wang, H., Vignali, D. A., Bergsagel, P. L., and Karin, M. (2008) Nonredundant and Complementary Functions of TRAF2 and TRAF3 in a Ubiquitination Cascade that Activates NIK-Dependent Alternative NF-kappaB Signaling. Nat Immunol. 9, 1364-1370.

  47. Zarnegar, B. J., Wang, Y., Mahoney, D. J., Dempsey, P. W., Cheung, H. H., He, J., Shiba, T., Yang, X., Yeh, W. C., Mak, T. W., Korneluk, R. G., and Cheng, G. (2008) Noncanonical NF-kappaB Activation Requires Coordinated Assembly of a Regulatory Complex of the Adaptors cIAP1, cIAP2, TRAF2 and TRAF3 and the Kinase NIK. Nat Immunol. 9, 1371-1378.

  48. Gardam, S., Sierro, F., Basten, A., Mackay, F., and Brink, R. (2008) TRAF2 and TRAF3 Signal Adapters Act Cooperatively to Control the Maturation and Survival Signals Delivered to B Cells by the BAFF Receptor. Immunity. 28, 391-401.

  49. Xiao, G., Harhaj, E. W., and Sun, S. C. (2001) NF-kappaB-Inducing Kinase Regulates the Processing of NF-kappaB2 p100. Mol Cell. 7, 401-409.

  50. Xiao, G., Fong, A., and Sun, S. C. (2004) Induction of p100 Processing by NF-kappaB-Inducing Kinase Involves Docking IkappaB Kinase Alpha (IKKalpha) to p100 and IKKalpha-Mediated Phosphorylation. J Biol Chem. 279, 30099-30105.

  51. Qing, G., and Xiao, G. (2005) Essential Role of IkappaB Kinase Alpha in the Constitutive Processing of NF-kappaB2 p100. J Biol Chem. 280, 9765-9768.

  52. Enzler, T., Bonizzi, G., Silverman, G. J., Otero, D. C., Widhopf, G. F., Anzelon-Mills, A., Rickert, R. C., and Karin, M. (2006) Alternative and Classical NF-Kappa B Signaling Retain Autoreactive B Cells in the Splenic Marginal Zone and Result in Lupus-Like Disease. Immunity. 25, 403-415.

  53. Otipoby, K. L., Sasaki, Y., Schmidt-Supprian, M., Patke, A., Gareus, R., Pasparakis, M., Tarakhovsky, A., and Rajewsky, K. (2008) BAFF Activates Akt and Erk through BAFF-R in an IKK1-Dependent Manner in Primary Mouse B Cells. Proc Natl Acad Sci U S A. 105, 12435-12438.

  54. Mecklenbrauker, I., Kalled, S. L., Leitges, M., Mackay, F., and Tarakhovsky, A. (2004) Regulation of B-Cell Survival by BAFF-Dependent PKCdelta-Mediated Nuclear Signalling. Nature. 431, 456-461.

  55. Woodland, R. T., Fox, C. J., Schmidt, M. R., Hammerman, P. S., Opferman, J. T., Korsmeyer, S. J., Hilbert, D. M., and Thompson, C. B. (2008) Multiple Signaling Pathways Promote B Lymphocyte Stimulator Dependent B-Cell Growth and Survival. Blood. 111, 750-760.

  56. Xu, L. G., Wu, M., Hu, J., Zhai, Z., and Shu, H. B. (2002) Identification of Downstream Genes Up-Regulated by the Tumor Necrosis Factor Family Member TALL-1. J Leukoc Biol. 72, 410-416.

  57. Yoshida, K. (2007) PKCdelta Signaling: Mechanisms of DNA Damage Response and Apoptosis. Cell Signal. 19, 892-901.

  58. Yuan, Z. M., Utsugisawa, T., Ishiko, T., Nakada, S., Huang, Y., Kharbanda, S., Weichselbaum, R., and Kufe, D. (1998) Activation of Protein Kinase C Delta by the c-Abl Tyrosine Kinase in Response to Ionizing Radiation. Oncogene. 16, 1643-1648.

  59. Sun, X., Majumder, P., Shioya, H., Wu, F., Kumar, S., Weichselbaum, R., Kharbanda, S., and Kufe, D. (2000) Activation of the Cytoplasmic c-Abl Tyrosine Kinase by Reactive Oxygen Species. J Biol Chem. 275, 17237-17240.

  60. Gibbons, J. J., Abraham, R. T., and Yu, K. (2009) Mammalian Target of Rapamycin: Discovery of Rapamycin Reveals a Signaling Pathway Important for Normal and Cancer Cell Growth. Semin Oncol. 36 Suppl 3, S3-S17.

  61. Acosta-Rodriguez, E. V., Craxton, A., Hendricks, D. W., Merino, M. C., Montes, C. L., Clark, E. A., and Gruppi, A. (2007) BAFF and LPS Cooperate to Induce B Cells to Become Susceptible to CD95/Fas-Mediated Cell Death. Eur J Immunol. 37, 990-1000.

  62. Boule, M. W., Broughton, C., Mackay, F., Akira, S., Marshak-Rothstein, A., and Rifkin, I. R. (2004) Toll-Like Receptor 9-Dependent and -Independent Dendritic Cell Activation by Chromatin-Immunoglobulin G Complexes. J Exp Med. 199, 1631-1640.

  63. Do, M. S., Jeong, H. S., Choi, B. H., Hunter, L., Langley, S., Pazmany, L., and Trayhurn, P. (2006) Inflammatory Gene Expression Patterns Revealed by DNA Microarray Analysis in TNF-Alpha-Treated SGBS Human Adipocytes. Yonsei Med J. 47, 729-736.

  64. Kim, M. Y., Kim, D. H., and Do, M. S. (2013) B-Cell-Activating Factor is a Regulator of Adipokines and a Possible Mediator between Adipocytes and Macrophages. Exp Mol Med. 45, e4.

  65. Tada, S., Yasui, T., Nakatsuji, Y., Okuno, T., Koda, T., Mochizuki, H., Sakoda, S., and Kikutani, H. (2013) BAFF Controls Neural Cell Survival through BAFF Receptor. PLoS One. 8, e70924.

  66. Baranzini, S. E., Jeong, M. C., Butunoi, C., Murray, R. S., Bernard, C. C., and Oksenberg, J. R. (1999) B Cell Repertoire Diversity and Clonal Expansion in Multiple Sclerosis Brain Lesions. J Immunol. 163, 5133-5144.

  67. Zhang, M., Ko, K. H., Lam, Q. L., Lo, C. K., Srivastava, G., Zheng, B., Lau, Y. L., and Lu, L. (2005) Expression and Function of TNF Family Member B Cell-Activating Factor in the Development of Autoimmune Arthritis. Int Immunol. 17, 1081-1092.

  68. Roschke, V., Sosnovtseva, S., Ward, C. D., Hong, J. S., Smith, R., Albert, V., Stohl, W., Baker, K. P., Ullrich, S., Nardelli, B., Hilbert, D. M., and Migone, T. S. (2002) BLyS and APRIL Form Biologically Active Heterotrimers that are Expressed in Patients with Systemic Immune-Based Rheumatic Diseases. J Immunol. 169, 4314-4321.

  69. Lai Kwan Lam, Q., King Hung Ko, O., Zheng, B. J., and Lu, L. (2008) Local BAFF Gene Silencing Suppresses Th17-Cell Generation and Ameliorates Autoimmune Arthritis. Proc Natl Acad Sci U S A. 105, 14993-14998.

  70. Ma, N., He, Y., Xiao, H., Han, G., Chen, G., Wang, Y., Wang, K., Hou, C., Yang, X., Marrero, B., Wang, Y., Shen, B., Li, Y., and Wang, R. (2014) BAFF Maintains T-Cell Survival by Inducing OPN Expression in B Cells. Mol Immunol. 57, 129-137.

  71. Jelinek, D. F., and Darce, J. R. (2005) Human B Lymphocyte Malignancies: Exploitation of BLyS and APRIL and their Receptors. Curr Dir Autoimmun. 8, 266-288.

  72. He, B., Chadburn, A., Jou, E., Schattner, E. J., Knowles, D. M., and Cerutti, A. (2004) Lymphoma B Cells Evade Apoptosis through the TNF Family Members BAFF/BLyS and APRIL. J Immunol. 172, 3268-3279.

  73. Mackay, F., and Tangye, S. G. (2004) The Role of the BAFF/APRIL System in B Cell Homeostasis and Lymphoid Cancers. Curr Opin Pharmacol. 4, 347-354.

  74. Novak, A. J., Grote, D. M., Stenson, M., Ziesmer, S. C., Witzig, T. E., Habermann, T. M., Harder, B., Ristow, K. M., Bram, R. J., Jelinek, D. F., Gross, J. A., and Ansell, S. M. (2004) Expression of BLyS and its Receptors in B-Cell Non-Hodgkin Lymphoma: Correlation with Disease Activity and Patient Outcome. Blood. 104, 2247-2253.

  75. Schiemann, B., Gommerman, J. L., Vora, K., Cachero, T. G., Shulga-Morskaya, S., Dobles, M., Frew, E., and Scott, M. L. (2001) An Essential Role for BAFF in the Normal Development of B Cells through a BCMA-Independent Pathway. Science. 293, 2111-2114.

  76. Gross, J. A., Dillon, S. R., Mudri, S., Johnston, J., Littau, A., Roque, R., Rixon, M., Schou, O., Foley, K. P., Haugen, H., McMillen, S., Waggie, K., Schreckhise, R. W., Shoemaker, K., Vu, T., Moore, M., Grossman, A., and Clegg, C. H. (2001) TACI-Ig Neutralizes Molecules Critical for B Cell Development and Autoimmune Disease. Impaired B Cell Maturation in Mice Lacking BLyS. Immunity. 15, 289-302.

  77. Gorelik, L., Cutler, A. H., Thill, G., Miklasz, S. D., Shea, D. E., Ambrose, C., Bixler, S. A., Su, L., Scott, M. L., and Kalled, S. L. (2004) Cutting Edge: BAFF Regulates CD21/35 and CD23 Expression Independent of its B Cell Survival Function. J Immunol. 172, 762-766.

  78. Vora, K. A., Wang, L. C., Rao, S. P., Liu, Z. Y., Majeau, G. R., Cutler, A. H., Hochman, P. S., Scott, M. L., and Kalled, S. L. (2003) Cutting Edge: Germinal Centers Formed in the Absence of B Cell-Activating Factor Belonging to the TNF Family Exhibit Impaired Maturation and Function. J Immunol. 171, 547-551.

  79. Jones, D. D., Jones, M., DeIulio, G. A., Racine, R., MacNamara, K. C., and Winslow, G. M. (2013) B Cell Activating Factor Inhibition Impairs Bacterial Immunity by Reducing T Cell-Independent IgM Secretion. Infect Immun. 81, 4490-4497.

  80. Yan, M., Brady, J. R., Chan, B., Lee, W. P., Hsu, B., Harless, S., Cancro, M., Grewal, I. S., and Dixit, V. M. (2001) Identification of a Novel Receptor for B Lymphocyte Stimulator that is Mutated in a Mouse Strain with Severe B Cell Deficiency. Curr Biol. 11, 1547-1552.

  81. Mackay, F., Woodcock, S. A., Lawton, P., Ambrose, C., Baetscher, M., Schneider, P., Tschopp, J., and Browning, J. L. (1999) Mice Transgenic for BAFF Develop Lymphocytic Disorders Along with Autoimmune Manifestations. J Exp Med. 190, 1697-1710.

  82. Khare, S. D., Sarosi, I., Xia, X. Z., McCabe, S., Miner, K., Solovyev, I., Hawkins, N., Kelley, M., Chang, D., Van, G., Ross, L., Delaney, J., Wang, L., Lacey, D., Boyle, W. J., and Hsu, H. (2000) Severe B Cell Hyperplasia and Autoimmune Disease in TALL-1 Transgenic Mice. Proc Natl Acad Sci U S A. 97, 3370-3375.

  83. McCarthy, D. D., Kujawa, J., Wilson, C., Papandile, A., Poreci, U., Porfilio, E. A., Ward, L., Lawson, M. A., Macpherson, A. J., McCoy, K. D., Pei, Y., Novak, L., Lee, J. Y., Julian, B. A., Novak, J., Ranger, A., Gommerman, J. L., and Browning, J. L. (2011) Mice Overexpressing BAFF Develop a Commensal Flora-Dependent, IgA-Associated Nephropathy. J Clin Invest. 121, 3991-4002.

  84. Groom, J., Kalled, S. L., Cutler, A. H., Olson, C., Woodcock, S. A., Schneider, P., Tschopp, J., Cachero, T. G., Batten, M., Wheway, J., Mauri, D., Cavill, D., Gordon, T. P., Mackay, C. R., and Mackay, F. (2002) Association of BAFF/BLyS Overexpression and Altered B Cell Differentiation with Sjogren's Syndrome. J Clin Invest. 109, 59-68.

  85. McCarthy, D. D., Chiu, S., Gao, Y., Summers-deLuca, L. E., and Gommerman, J. L. (2006) BAFF Induces a Hyper-IgA Syndrome in the Intestinal Lamina Propria Concomitant with IgA Deposition in the Kidney Independent of LIGHT. Cell Immunol. 241, 85-94.