Phenotypic Mutation 'Frozen' (pdf version)
List |< first << previous [record 8 of 18] next >> last >|
AlleleFrozen
Mutation Type splice donor site (5 bp from exon)
Chromosome8
Coordinate10,031,661 bp (GRCm38)
Base Change G ⇒ A (forward strand)
Gene Tnfsf13b
Gene Name tumor necrosis factor (ligand) superfamily, member 13b
Synonym(s) D8Ertd387e, BAFF, BLyS, TALL-1, zTNF4
Chromosomal Location 10,006,467-10,039,072 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptors TNFRSF13B/TACI, TNFRSF17/BCMA, and TNFRSF13C/BAFFR. This cytokine is expressed in B cell lineage cells, and acts as a potent B cell activator. It has been also shown to play an important role in the proliferation and differentiation of B cells. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice have reduced number of B cells and reduced levels of immunoglobulins. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_033622; MGI:1344376

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033892] [ENSMUSP00000146694] [ENSMUSP00000146904]
SMART Domains Protein: ENSMUSP00000033892
Gene: ENSMUSG00000031497

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
TNF 169 308 1.88e-2 SMART
Predicted Effect probably null
Predicted Effect probably null
Predicted Effect probably benign
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased 11509691
FACS B1a cells - increased 16987502
FACS CD11c+ DCs - increased
FACS CD4+ T cells - increased 11520463
FACS CD8+ T cells - increased 11520463
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - decreased 11509691
FACS IgM MFI - increased
FACS IgM+ B cells - decreased 11509691
FACS macrophages - increased
FACS neutrophils - increased
FACS T cells - increased 11520463
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Penetrance  
Alleles Listed at MGI

All mutations/alleles(7) : Chemically induced (ENU)(1) Targeted(5) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Tnfsf13b APN 8 10031612 missense probably damaging 1.00
IGL01383:Tnfsf13b APN 8 10031528 missense probably damaging 0.98
IGL01650:Tnfsf13b APN 8 10031411 missense probably damaging 1.00
Applecrisp UTSW 8 10031534 missense probably damaging 1.00
F5493:Tnfsf13b UTSW 8 10006916 missense probably damaging 1.00
R0610:Tnfsf13b UTSW 8 10031661 splice site probably null
R0723:Tnfsf13b UTSW 8 10007166 splice site probably null
R1435:Tnfsf13b UTSW 8 10035358 missense probably benign 0.06
R1648:Tnfsf13b UTSW 8 10031534 missense probably damaging 1.00
R1744:Tnfsf13b UTSW 8 10031661 splice site probably null
R2266:Tnfsf13b UTSW 8 10007306 missense probably benign 0.23
R3723:Tnfsf13b UTSW 8 10031545 missense possibly damaging 0.48
R5230:Tnfsf13b UTSW 8 10031608 missense possibly damaging 0.80
R5913:Tnfsf13b UTSW 8 10006988 missense probably damaging 1.00
R6741:Tnfsf13b UTSW 8 10007314 missense possibly damaging 0.66
Mode of Inheritance Autosomal Semidominant
Local Stock Live Mice
MMRRC Submission 038182-MU
Last Updated 2016-12-08 10:17 AM by Katherine Timer
Record Created 2014-05-15 1:38 PM by Kuan-Wen Wang
Record Posted 2015-06-20
Phenotypic Description

Figure 1. Frozen mice exhibit decreased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Frozen mice exhibit decreased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Frozen mice exhibit decreased percentages of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentages. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Frozen mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Frozen mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Frozen mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Frozen mice exhibit diminished T-independent IgM responses to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll). IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Frozen phenotype was identified among N-ethyl-N-nitrosourea  (ENU)-mutagenized G3 mice of the pedigree R0610, some of which showed a reduced frequency of B cells (Figure 1), a reduced frequency of IgM+ B cells (Figure 2), a decreased percentage of IgD+ B cells (Figure 3), an increased frequency of T cells (Figure 4), and an increased frequency of CD8+ T cells (Figure 5), all in the peripheral blood. Some mice also had a diminished T-dependent antibody response to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) (Figure 6). The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also reduced (Figure 7). 

Nature of Mutation

Figure 8. Linkage mapping of the reduced peripheral IgM+ B cell frequency using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 96 mutations (X-axis) identified in the G1 male of pedigree R0610.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 96 mutations. All of the above phenotypic anomalies were linked by continuous variable mapping to a mutation in Tnfsf13b: a T to A transversion at base pair 10,031,661 (v38) on chromosome 8, or base pair 25,469 in the GenBank genomic region NC_000074 within the donor splice site of intron 6. The strongest association was found with an additive model of linkage to the normalized frequency of peripheral IgM+ B cells, wherein 10 variant homozygotes and 19 heterozygotes departed phenotypically from 15 homozygous reference mice with a P value of 1.00 x 10-17 (Figure 8).  The effect of the mutation at the cDNA and protein level have not examined, but the mutation is predicted to result in skipping of the 151-nucleotide exon 6 (out of 7 total exons), a frame-shift that results in coding of 34 aberrant amino acids followed by a premature stop codon.

 

              <--exon 5         <--exon 6 intron 6-->       exon 7-->
25216 ……TTCATCTACAGCCAG……TCCTGCTACTCGGCTG gtatgtagctgtcct…… GCATCGCGAGGCTGG……TCTTTGGTGCCCTAA 

218   ……-F--I--Y--S--Q-……-S--C--Y--S--A--                   -A--S--R--G--W-……-S--L--V--P--*

            correct          deleted                                     aberrant

 

Genomic numbering corresponds to NC_000074. The donor splice site of intron 6, which is destroyed by the frozen mutation, is indicated in blue lettering and the mutated nucleotide is indicated in red.

Protein Prediction

Figure 9. Domain structure of BAFF. BAFF is a type II transmembrane protein. BAFF is cleaved by furin-like proteases between Arg126 and Ala127 to produce soluble BAFF (sBAFF). The Frozen mutation is shown. Abbreviations: TM, transmembrane domain; THD, TNF homology domain. See the text for more details.

Tnfsf13b encodes B cell activating factor (BAFF; alternatively, BLyS, TALL-1, zTNF-4, THANK, or TNFSF13), a member of the tumor necrosis factor (TNF) family (Figure 9). BAFF is a type II transmembrane protein that undergoes cleavage between Arg126 and Ala127 by furin-like proteases to generate a soluble form of BAFF (sBAFF) (1-3). Both the full-length and soluble forms of BAFF are biologically active (1;2). The full-length form of BAFF is proposed to function in the maintenance of peripheral B2 B cells, mediate the production of basal levels of IgA, and regulate the differentiation of marginal zone B cells (4). The soluble form of BAFF is essential for B cell development and T-independent type 2 humoral responses (4).

 

The extracellular TNF homology domain (THD) of BAFF (amino acids 169-308) mediates binding to the BAFF receptor [BAFFR; alternatively, BR3 (BLyS receptor 3)] and shows highest shared identity with APRIL (a proliferation-inducing ligand; 33% amino acid identity, 48% homology), another member of the TNF family, and lesser identity (<20%) with TNF family proteins TNFα (see the record for Panr1), TRAIL (TNF-related apoptosis-inducing ligand), RANKL (receptor activator of NF-κB ligand), and LT-α (lymphotoxin-α; see the record for kama) [(1;5;6); reviewed in (7)].

 

Figure 10. Model of a soluble human BAFF trimer. UCSF Chimera model is based on PDB: 1JH5. Click on the image to view the structure rotate.

Figure 11. Model of the human BAFF-BAFF receptor interaction. The soluble form of BAFF and the extracellular domain of the BAFFR are modeled. UCSF Chimera model is based on PDB: IOQE. Click on the image to view the structure rotate.

At low pH, the sBAFF monomer consists of two layers of anti-parallel β-strands that fold into a jellyroll-like β-sandwich topology similar to other TNF family ligands [Figure 10; PDB:1JH5; (8-15)]. Two unique features in sBAFF to other TNF ligands is the presence of an elbow region containing a short β-hairpin and a flap region (9). Soluble BAFF is active as a trimer. The trimer interface is comprised mainly of layered aromatic residues including Phe194, Tyr196, and Tyr246 (numbering corresponds to the human BAFF protein) from three BAFF monomers (9). Gln144 from each of the three monomers forms a hydrogen bond net and Leu285 from each monomer also forms an interaction layer (9). The flap region mediates trimer-trimer interactions. Tyr192, Lys252, Glu254, and His218 from two monomers interact to form layer 1 of the trimer interace. A second layer is composed of Lys216, Glu223, Leu224, Val227, and Leu229 from each monomer. At neutral or basic pH, sBAFF trimers assemble into a 60-mer virus-like cluster (9). The physiological importance of the cluster formation is not known. Coexpression of human sBAFF with either BCMA (B cell maturation antigen) or BAFFR, in solution generates the virus-like cluster [Figure 11; PDB: 1OQE; (15)]. sBAFF and BCMA interact at a one-to-one ratio (15). Eight residues in the primary sBAFF (Tyr163, Tyr206, Leu211, Arg231, Ile233, Pro264, Arg265 and Glu266; human protein sequence numbering) and four from the secondary sBAFF ligand (Leu200, Leu240, Asp273 and Asp275) interact with nine residues in BCMA (Tyr13, Asp15, Leu17, Leu18, His19, Ile22, Leu26, Arg27 and Pro34) (15). The interaction of BAFF with the BAFFR is mediated by Tyr163, Asp203, Tyr206, Leu211, Arg231, Ile233, Pro264, Arg265, Glu266 and Asn267 from the primary sBAFF as well as Leu200, Leu240, Asp273 and Asp275, and Asp222 from a neighboring sBAFF trimer (15).

 

Mouse Tnfsf13b can undergo alternative splicing that results in skipping of exon 4 (exon 4 encodes the first β-sheet of the THD (amino acids 156-184); Gly185 is substituted with an Arg) and creation of a functional N-linked glycosylation site at Asn155 to produce a splice variant called ΔBAFF [(8); reviewed in (7)]. The ΔBAFF isoform is able to assemble into disulfide-linked complexes with itself as well as full-length BAFF (8). Association of ΔBAFF with BAFF prevents release of sBAFF and results in formation of inactive homotrimers (8;16). The ΔBAFF variant is expressed in all myeloid cell lines examined as well as in bone marrow-derived macrophages (8). Transgenic mice expressing ΔBAFF in myeloid and dendritic cells exhibited reduced follicular and marginal zone B cell numbers and diminished T-dependent humoral responses; the T cell-independent response was not affected (16). The frequency of Th17 cells was increased in the BAFF-Tg mice (17).

 

The Frozen mutation is predicted to alter the sequence of the THD. Alteration of the THD may result in aberrant association of BAFFFrozen with its receptors and/or the formation of inactive homotrimers.

Expression/Localization

Tnfsf13b is expressed in peripheral blood mononuclear cells, spleen, lymph node, and bone marrow as well as at lower levels in placenta, fetal liver, heart, lung, thymus, small intestine, and pancreas (1;2;6;18;19). The BAFF protein is expressed in monocytes, macrophages, dendritic cells, neutrophils, some subpopulations of B and T cells, stromal cells, malignant B cells, epithelial cells, adipocytes, the brain, and astrocytes (1-3;6;20-24)

 

BAFF expression is upregulated by several cytokines including IFN-α (see the record for macro-1), IFN-γ, and IL-10 as well as by growth factors and estrogen (20;21;25). BAFF expression is upregulated by TLR4 (see the record for lps3) and TLR9 (see the record for Cpg1) signaling (19). BAFF expression in germinal center B cells was induced upon immunization with the T-dependent antigen 2-phenyl-oxazolone (19). Reactive oxygen species generated by serum deprivation also increased BAFF expression, while antioxidants and nitric oxide inhibited BAFF expression (26;27). Estrogen-mediated regulation of Tnfsf13b resulted in higher steady-state expression in CD11b+, CD11c+, and CD19+ cells in female mice compared to that in male mice.

Background
Figure 12. BAFF in B-Cell Signaling. BAFF binds to three receptors BCMA, TACI, and BAFFR. BCMA can activate NF-κB through TRAF5 (TNF Receptor-Associated Factor-5), TRAF6, TRAF3, NIK (NF-KappaB Inducing Kinase), and IKK (I-KappaB Kinase)-dependent pathway. Engagement of BCMA also activates JNK (Jun N-terminal Kinases), p38 MAPK (Mitogen Activated Protein Kinase) and the transcription factor Elk1. The intracellular domain of TACI associates with TRAFs and activates NF-κB, NFAT (Nuclear Factor of Activated T-Cells) and JNK. The binding of BAFF to BAFFR is primarily responsible for supporting transitional B-Cell maturation and enhancing the survival of mature B-Cells. See the text for more details. Some of the protein images are modeled after crystal structures: p38 and ERK2, PDB:1LEZ; SEK1/MKK4, PDB: 3ALN; MKK7, PDB:3WZU; JNK, PDB:1JNK; BCMA, PDB:1XU2; TACI, PDB:1XUT; TRAF1:TRAF2:cIAP2, PDB:3M0D; TRAF6, PDB:1LB5; BAFFR, PDB:1OQE; MAP2K7, PDB:3WZU, NFAT, PDB:2JOG; TAK1, PDB:3A9K; TRAF2, PDB:2X7F.

BAFF can bind to three TNF receptor family members: BCMA, TACI (transmembrane activator and calcium modulator ligand (CAML) interactor), and BAFFR [Figure 12; (28;29); reviewed in (30)]. BCMA is expressed on B cells and is dispensable for early B cell differentiation, but functions in long-term maintenance of bone marrow plasma cells (31). BAFF- or APRIL-mediated activation of BCMA is sufficient to support plasma cell survival (32). TACI is expressed on mature follicular, marginal zone, T2, and T3 transitional B cells as well as on activated T cells (33). TACI is proposed to be a negative regulator B cells (33;34), but promotes IgA class switching (35). TACI-deficient mice have a higher number of follicular and marginal zone B cells, but the ratio of maturing B cell subsets in the spleen is normal (33). In addition, TACI-deficient mice have reduced T cell-independent antibody responses (33).

 

BAFFR is expressed on mature follicular and marginal zone B cells as well as on T2 and T3 transitional B cells, plasma cells, and plasmablasts (29;36). BAFF/BAFFR signaling is essential for B cell homeostasis, differentiation, proliferation, survival, and function (1;2;19;37;38). Proliferation of anti-IgM-stimulated peripheral B cells is induced by both membrane-bound and sBAFF (1). BAFF also functions in the induction of IL-10-producing regulatory B cell (CD1dhiCD5+) differentiation from marginal zone B cells that suppress T cell proliferation and Th1 cytokine production (39). BAFF/BAFFR activates the alternative NF-κB (NF-κB2) signaling pathway (see the record for xander) to mediate the survival and maturation of splenic B cells (40;41). The non-canonical NF-κB pathway drives the post-translational processing of p100 to mature p52 through IKK-1 and NIK, and results in the activation of p52/RelB heterodimers (42;43). TRAF2 and TRAF5 positively regulate NIK activity under certain conditions (44), but in other contexts, TRAF2 and TRAF3 form a complex with NIK to mediate NIK degradation (45-48). After stimulation with BAFFR, the complex is destabilized by TRAF2/3 degradation, permitting the release of NIK from the complex (46-48). After NIK is activated, it is able to bind to and phosphorylate several substrates including IKK-1 and p100, and serves as a docking molecule between IKK-1 and p100 (49-51). Phosphorylation of p100 by IKK-1 results in polyubiquitination and processing to p52 (50). BAFF/BAFFR-induced NF-κB2 signaling promotes B cell survival by upregulating integrins that retains autoreactive B cells in the splenic marginal zone (52). In addition, ERK activation is sustained and there is an increased turnover of Bim, a proapoptotic protein (40;41;53). BAFF activates the classical NF-κB (NF-κB1) signaling pathway (see the record for Finlay) to regulate immunoglobulin class switching through an induction of activation induced deaminase (AID) and to generate antibodies (52).

 

BAFF also induces the protein kinase Cδ (PKCδ) and Akt/mTOR signaling pathways to regulate B-cell survival (53-56). PKCδ functions in regulating apoptotic cell death [reviewed in (57)]. The tyrosine kinase c-Abl phosphorylates PKCδ in response to genotoxic and oxidative stress (58;59). PKCδ phosphorylation activates the protein and facilitates the translocation of PKCδ to the nucleus. Within the nucleus, PKCδ phosphorylates histone H2B and subsequently regulates peripheral B cell death (54). BAFF prevents the nuclear accumulation of PKCδ. The mTOR-associated signaling pathway regulates cell growth, size, metabolism, and growth factor signaling by stimulating protein synthesis. BAFF binding to the BAFFR activates phosphoinositide 3-kinase (PI3K), an upstream activator of mTOR, which subsequently activates Akt (60). BAFF-stimulated activation of mTOR leads to subsequent phosphorylation of mTOR targets p70 S6 kinase and the translational inhibitor 4E-BP1 as well as the activation of Akt targets forkhead transcription factors FOXO3a and FOXO1 [reviewed in (30)].

 

TLR-associated signaling can regulate BAFF secretion and subsequent signaling. TLR2, TLR4, and TLR9 activation stimulates myeloid dendritic cells and macrophages to secrete BAFF, which subsequently promotes BCR- and CD40-induced B cell proliferation (21;61;62) and class switch recombination (35). B cells activated with both LPS (the TLR4 ligand) and BAFF/BAFFR are protected from spontaneous apoptosis, but are more susceptible to Fas (see the record for cherry)-mediated cell death due to an upregulation of MEK/ERK-associated Fas and IRF-4 expression (61). The BAFF-induced upregulation of Fas is restricted to TLR4-activated B cells, but not B cells activated by TLR9, the B cell receptor, or CD40 (61).

 

BAFF has additional functions outside of B cell regulation. BAFF is proposed to be an adipokine that links obesity and inflammation (23;24). BAFF expression is increased in adipocytes during adipocyte differentiation as well as during TNF-α treatment (23;63). In 3T3-L1 adipocytes BAFF decreased expression of the adipokines leptin (see the record for Potbelly) and adiponectin, but increased the expression of the proinflammatory adipokines monocyte chemotactic protein-1 (CCL2), interleukin-6 (IL-6), cyclooxygenase-2 (COX-2) and haptoglobin (64). Kim et al. propose that BAFF not only regulates adipokine expression, but also mediates adipocyte and macrophage interaction (64). BAFF also functions as a neurotrophic factor to regulate neural cell survival (65). In an animal model of inherited amyotrophic lateral sclerosis, BAFFR-associated signaling was impaired. Loss of BAFFR expression in B cells or in bone marrow cells did not alter disease progress indicting that it is the BAFF-mediated signals on neurons that support neural cell survival (65). In the brains of patients with multiple sclerosis, BAFF promotes survival of BAFFR-expressing B cells, allowing for the clonal expansion of B cells in the central nervous system (22;66).

 

Elevated circulating levels of BAFF have been observed in several human pathological conditions including rheumatoid arthritis (RA), multiple sclerosis, systemic lupus erythematosus (SLE), and Sjögren's syndrome (SS). BAFF can also form heterotrimers with APRIL (67;68). Increased levels of BAFF/APRIL heterotrimers have been noted in the serum of patients with autoimmune diseases (68). Tnfsf13b silencing using a lentivirus expressing Tnfsf13b shRNA resulted in long-term suppression of arthritis development in a collagen-induced arthritis model (69). BAFF promotes the expansion of Th17 cells and IL-17 is a major effector cytokine for the BAFF-mediated proinflammatory effects observed in arthritis (69). Inhibition of BAFF expression resulted in reduced proinflammatory cytokine expression as well as reduced generation of plasma cells and Th17 cells.  In a murine model of collagen-induced arthritis, macrophages and dendritic cells produced elevated amounts of BAFF; increased levels of BAFF secreted by DCs occurred at the early stage of arthritis development, while macrophage BAFF secretion correlated with later stages of arthritis (67). In addition, DC-secreted BAFF resulted in increased peripheral B cell proliferation and survival. In multiple sclerosis, high levels of BAFF result in dysregulation of T cell survival and apoptosis. BAFF blockade with TACI-IgG reduced T cell survival in myelin oligodendroglia glycoprotein (MOG)-induced chronic experimental allergic encephalitis (EAE) (70). In addition, BAFF expression induced Bcl2 expression and subsequent apoptosis in T cells by upregulating osteopontin (OPN) secretion from B cells via NF-κB signaling (70). BAFF facilitates the survival of both malignant (e.g., multiple myelomas, lymphomas and non Hodgkin's leukemias) and autoreactive B cells (71-74).

Putative Mechanism

Several mouse models were developed to study the function of BAFF. Early B cell development in the bone marrow of BAFF-deficient (Tnfsf13b-/-) mice is normal (1); however, B cell maturation is impaired beyond the immature transitional type 1 (T1; CD21/35CD23) stage (5;38;75). Therefore, more than 90% of mature B cells including transitional T2 (CD21/35highCD23+), mature follicular (IgMdullIgDhiCD21/35lowCD23+), and marginal zone B cells (IgMhiIgDCD21/35highCD23) are lost (5;75;76). The percentage of peripheral B1 B cells in the Tnfsf13b-/- mice was comparable to that in wild-type mice; however, the B2 (B220+, CD23hi) B cell percentage in the periphery was reduced compared to wild-type mice (75-77). The numbers of thymocyte populations (i.e., CD4 and CD8 T cells) and CD3+ peripheral T cells in the spleen and lymph nodes were comparable between the Tnfsf13b-/- and wild-type mice (75;76). However, the numbers of CD44+CD62L memory/effector T cells were reduced in the Tnfsf13b-/- mice compared to those in wild-type mice (76). The Tnfsf13b-/- mice exhibit reduced levels of serum IgG and IgM compared to those in wild-type mice (75;76). IgA was only moderately reduced (75). The T-dependent and T-independent humoral responses were diminished in the Tnfsf13b-/- mice due to loss of BAFF-regulated terminal plasmablast differentiation and/or IgM secretion (5;75;76;78-80). Mice that overexpress BAFF (BAFF-Tg) exhibit increased mature B cells in the periphery, spontaneous germinal center reactions, enlarged lymphoid organs and spleens, anti-DNA antibodies, proteinuria, hypergammaglobulinemia, and glomerulonephritis (75;81;82). Together, these phenotypes are similar to SLE and SS in humans (83;84). The BAFF-Tg mice have mesangial deposits of IgA with a concomitant increase in circulating polymeric IgA (83;85). The renal disease exhibited by the BAFF-Tg mice was due to the elevation in serum IgA (83). Th17 cells were increased in the BAFF-Tg mice (17). In addition, the levels of circulating Ig is increased in transgenic mice overexpressing BAFF (73;82;84). The phenotypes observed of the Frozen mice are similar to the Tnfsf13b-/- mice (1), indicating that, if expressed, BAFFFrozen exhibits loss of function.

Primers PCR Primer
Frozen(F):5'- CTATACACGGACCCCATCTTTGCTATG -3'
Frozen(R):5'- TGCTCCAATGTCAAATTCTGTGACCC -3'

Sequencing Primer
Frozen_seq(F):5'- CTATGGGTCATGTCATCCAGAG -3'
Frozen_seq(R):5'- actgcctctccatcccc -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsBruce Beutler, Jin Huk Choi, Kuan-Wen Wang, Ming Zeng
List |< first << previous [record 8 of 18] next >> last >|