Phenotypic Mutation 'date'

• Allele: date
• Mutation Type: missense
• Chromosome: 17
• Coordinate: 34,431,328 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Tap2
• Gene Name: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
• Synonym(s): HAM2, MTP2, PSF2, Abcb3, Ham2, Ham-2, Tap-2
• Chromosomal Location: 34,423,453-34,435,295 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in antigen presentation. This protein forms a heterodimer with Tap1 in order to transport peptides from the cytoplasm to the endoplasmic reticulum. Mutations in the human gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mutant mice have no CD8+ T cells, although their numbers of CD4+ T cells and B cells are normal. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Valine changed to Aspartic acid
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000025197]
• AlphaFold: P36371
• SMART Domains: Protein: ENSMUSP00000025197; Gene: ENSMUSG00000024339; AA Change: V422D

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
transmembrane domain	55	77	N/A	INTRINSIC
transmembrane domain	97	119	N/A	INTRINSIC
Pfam:ABC_membrane	151	419	1.8e-62	PFAM
AAA	494	678	2.58e-19	SMART

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
  (Using ENSMUST00000025197)
• Meta Mutation Damage Score: 0.6467
• Is this an essential gene?: Probably nonessential (E-score: 0.206)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice
• MMRRC Submission: 038153-MU
• Last Updated: 2019-02-12 11:41 AM by Diantha La Vine
• Record Created: 2014-05-16 5:35 PM by Kuan-Wen Wang
• Record Posted: 2015-01-21
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Peter Jurek
• Authors: Bruce Beutler, Jin Huk Choi, Kuan-Wen Wang, Ming Zeng

Accession Number

NCBI RefSeq: NM_011530; MGI: 98484

Alleles Listed at MGI

All mutations/alleles(2) : Chemically induced (ENU)(2)

Phenotypic Description

Figure 1. Date mice exhibit an increased CD4 + to CD8 + T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + and CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Date mice exhibit decreased CD8 + T cell frequencies in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Date mice exhibit decreased frequencies of CD8 + T cell in CD3 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD8 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Date mice exhibit increased frequencies of CD4 + T cell in CD3 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD4 + T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Date mice exhibit increased CD44 + mean fluorescence intensity (MFI) on CD8 + T cells in the peripheral blood. Flow cytometric analysis of peripheral blood was utilized to determine CD44 + MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The date phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0595, some of which showed an increase in the CD4⁺ to CD8⁺ T cell ratio (Figure 1) caused by a diminished frequency of CD8⁺ T cells (Figure 2) and CD8⁺ T cells in CD3⁺ T cells (Figure 3) with a concomitant increase in the CD4⁺ T cell frequency in CD3⁺ T cells (Figure 4), all in the peripheral blood. An increase in the CD44⁺ mean fluorescence intensity on CD8⁺ T cells was also observed (Figure 5).

Nature of Mutation

Figure 6. Linkage mapping of the reduced CD4 + to CD8 + T cell ratio using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 50 mutations (X-axis) identified in the G1 male of pedigree R0595. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 50 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Tap2:  a T to A transversion at base pair 34,212,354 (v38) on chromosome 17, or base pair 8,270 in the GenBank genomic region NC_000083.  The strongest association was found with a recessive model of linkage to the raw CD4⁺ to CD8⁺ T cell ratio, wherein 5 variant homozygotes departed phenotypically from 12 homozygous reference mice and 18 heterozygous mice with a P value of 2.097 x 10^-18 (Figure 6).  A substantial semidominant effect was observed in most of the assays but the mutation is preponderantly recessive, and in no assay was a purely dominant effect observed.  The mutation corresponds to residue 1,418 in the mRNA sequence NM_011530 within exon 7 of 12 total exons.

1402 GAAGTGGGACAATATGTCCGGAACCTGGTTTAC 417  -E--V--G--Q--Y--V--R--N--L--V--Y-

The mutated nucleotide is indicated in red.  The mutation results in a valine (V) to aspartic acid (D) substitution at position 422 (V422D) in the Tap2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.989).

Protein Prediction

Figure 7. Domain organization and predicted membrane topology of TAP. Top, domain structure of TAP2. Below, Topography of TAP1/TAP2. Both TAP1 and TAP2 contain a 6-helix core transmembrane domain (TMD; purple) and a cytosolic nucleotide binding domain (NBD). Tapasin binding N-terminal accessory domains (pink) consist of 4 and 3 transmembrane helices for TAP1 and TAP2, respectively. The Walker A (A), Walker B (B), and signature/C-loop motif (C) sequences, involved in ATP biding and/or hydrolysis, and color coded to indicate to which ATPase site they belong (green = consensus site,; orange = degenerate site). The date mutation results in a valine to aspartic acid substitution at position 422. The image is interactive. Other mutations found in TAP2 are noted in red. Click on each allele for more information.

The transporter associated with antigen processing (TAP) pumps cytosolic peptides into the endoplasmic reticulum (ER) lumen for loading onto class I major histocompatibility (MHC) molecules and presentation to T lymphocytes. TAP is a member of the ATP-binding cassette (ABC) transporter family, ubiquitous proteins that shuttle a variety of substrates, including ions, sugars, amino acids, peptides, vitamins, lipids, antibiotics, and drugs, across cellular membranes (1;2). TAP is a heterodimer of the homologous TAP1 (724 amino acids in mice) and TAP2 proteins (702 amino acids in mice), each of which contains a six-helix TMD, a C-terminal NBD, and three transmembrane N-terminal accessory domains (Figure 7). The date mutation results in a valine to aspartic acid substitution at amino acid 422 (V422D) located in transmembrane 6 of the core transmembrane domain.

Please see the record for ganymede for information about Tap2.

Putative Mechanism

TAP is essential for the transport of peptides into the ER for loading onto MHC class I molecules and display at the cell surface. Peptide binding is required to stabilize MHC class I molecules, so mice with disrupted TAP1 or TAP2 genes assemble drastically reduced amounts of MHC class I molecules, and have nearly absent surface expression of MHC class I.  The cells of Tap1^-/- mice (3) and mice with an ENU-induced point mutation in TAP2 (Tap2^jasmine) (4) are deficient in cytosolic antigen presentation, and consequently CD8⁺ T cells fail to develop in these animals. Similarly, human mutations in TAP1 (5;6), TAP2 (7;8), or tapasin (9) cause the rarely occurring bare lymphocyte syndrome type I (type I BLS, OMIM #604571), characterized a reduction in MHC class I surface expression to 1-3% of normal levels. The lack of CD8⁺ T cells in date is due to death after failure to interact with peptide-MHC class I in the thymus, which is known to promote the development and maintenance of these T cells. 

Primers

PCR Primer
date_pcr_F: AGATTCTGGCTGGAGAGGTCAC
date_pcr_R: GCAGTTAGGGATAAGATTAGCCAGG

Sequencing Primer
date_seq_F: TGGAGAGGTCACCCGGGGTG
date_seq_R: TAATTTAGGGTGGAGTCAGG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 402 nucleotides is amplified (chromosome 17, + strand):

1   agattctggc tggagaggtc acccggggtg gcctgctctc cttcctgctg taccaggagg
61  aagtgggaca atatgtccgg gtgagtgagg tgcactcatg agatgctctg tgtttccatc
121 tgggcttctg ggccatgagt taattttctc atggataatt ttaaacatgc tttaaaaaag
181 ccattattgt gataagtctt caggtaactt ttatcagctt tgacaatgat cataacccta
241 aattaaccca aaccccaacc ctaactccac cataaccaac tctaacccta gcctgactcc
301 accctaaatt aatactaact ctaacctcat ctaaacaact tcaattctaa atagccataa
361 tgatatctta cccccaccct ggctaatctt atccctaact gc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Borst, P., and Elferink, R. O. (2002) Mammalian ABC Transporters in Health and Disease. Annu Rev Biochem. 71, 537-592.

  2. Higgins, C. F. (1992) ABC Transporters: From Microorganisms to Man. Annu Rev Cell Biol. 8, 67-113.

  3. Van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L., and Tonegawa, S. (1992) TAP1 Mutant Mice are Deficient in Antigen Presentation, Surface Class I Molecules, and CD4-8+ T Cells. Cell. 71, 1205-1214.

  4. Theodoratos, A., Whittle, B., Enders, A., Tscharke, D. C., Roots, C. M., Goodnow, C. C., and Fahrer, A. M. (2010) Mouse Strains with Point Mutations in TAP1 and TAP2. Immunol Cell Biol. 88, 72-78.

  5. de la Salle, H., Zimmer, J., Fricker, D., Angenieux, C., Cazenave, J. P., Okubo, M., Maeda, H., Plebani, A., Tongio, M. M., Dormoy, A., and Hanau, D. (1999) HLA Class I Deficiencies due to Mutations in Subunit 1 of the Peptide Transporter TAP1. J Clin Invest. 103, R9-R13.

  6. Furukawa, H., Murata, S., Yabe, T., Shimbara, N., Keicho, N., Kashiwase, K., Watanabe, K., Ishikawa, Y., Akaza, T., Tadokoro, K., Tohma, S., Inoue, T., Tokunaga, K., Yamamoto, K., Tanaka, K., and Juji, T. (1999) Splice Acceptor Site Mutation of the Transporter Associated with Antigen Processing-1 Gene in Human Bare Lymphocyte Syndrome. J Clin Invest. 103, 755-758.

  7. de la Salle, H., Hanau, D., Fricker, D., Urlacher, A., Kelly, A., Salamero, J., Powis, S. H., Donato, L., Bausinger, H., and Laforet, M. (1994) Homozygous Human TAP Peptide Transporter Mutation in HLA Class I Deficiency. Science. 265, 237-241.

  8. Moins-Teisserenc, H. T., Gadola, S. D., Cella, M., Dunbar, P. R., Exley, A., Blake, N., Baykal, C., Lambert, J., Bigliardi, P., Willemsen, M., Jones, M., Buechner, S., Colonna, M., Gross, W. L., and Cerundolo, V. (1999) Association of a Syndrome Resembling Wegener's Granulomatosis with Low Surface Expression of HLA Class-I Molecules. Lancet. 354, 1598-1603.

  9. Yabe, T., Kawamura, S., Sato, M., Kashiwase, K., Tanaka, H., Ishikawa, Y., Asao, Y., Oyama, J., Tsuruta, K., Tokunaga, K., Tadokoro, K., and Juji, T. (2002) A Subject with a Novel Type I Bare Lymphocyte Syndrome has Tapasin Deficiency due to Deletion of 4 Exons by Alu-Mediated Recombination. Blood. 100, 1496-1498.