Phenotypic Mutation 'cherry' (pdf version)
List |< first << previous [record 66 of 511] next >> last >|
Allelecherry
Mutation Type missense
Chromosome19
Coordinate34,327,140 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Fas
Gene Name Fas (TNF receptor superfamily member 6)
Synonym(s) APO-1, CD95, TNFR6, Tnfrsf6
Chromosomal Location 34,290,659-34,327,770 bp (+)
MGI Phenotype Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease.
Accession Number

NCBI RefSeq: NM_007987, NM_001146708; MGI:95484

Mapped Yes 
Amino Acid Change Valine changed to Alanine
Institutional SourceBeutler Lab
Gene Model predicted sequence gene model
PDB Structure
Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: V267A

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
(Using ENSMUST00000025691)
Phenotypic Category decrease in CD4+ T cells, decrease in CD8+ T cells, decrease in T cells, increase in neutrophils, increase in NK cells
Penetrance  
Alleles Listed at MGI

All alleles(11) : Chemically induced (ENU)(1) Spontaneous(2) Targeted(8)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34318618 missense possibly damaging 0.82
IGL01677:Fas APN 19 34318818 missense probably benign 0.00
IGL01834:Fas APN 19 34318603 missense probably benign 0.00
IGL02130:Fas APN 19 34315295 missense probably benign 0.00
IGL02424:Fas APN 19 34327034 missense probably damaging 1.00
IGL02532:Fas APN 19 34316599 missense possibly damaging 0.91
IGL02569:Fas APN 19 34320562 missense probably damaging 1.00
P0021:Fas UTSW 19 34307210 missense probably benign 0.01
R0525:Fas UTSW 19 34319327 missense probably damaging 1.00
R0588:Fas UTSW 19 34327140 missense probably damaging 0.99
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R1465:Fas UTSW 19 34316613 missense probably damaging 1.00
R2077:Fas UTSW 19 34320553 splice acceptor site probably benign
R2283:Fas UTSW 19 34307249 missense possibly damaging 0.85
R4154:Fas UTSW 19 34318828 missense possibly damaging 0.72
R5252:Fas UTSW 19 34316643 missense probably damaging 0.99
R5943:Fas UTSW 19 34320587 unclassified probably null
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
MMRRC Submission 037602-MU
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 05/21/2014 9:47 PM by Ming Zeng
Record Posted 12/19/2014
Phenotypic Description

Figure 1. Homozygous cherry mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Homozygous cherry mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD4+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Homozygous cherry mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD8+ T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Homozygous cherry mice exhibit increased frequencies of peripheral natural killer (NK) cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Homozygous cherry mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The cherry phenotype was identified among G3 mice of the pedigree R0588, some of which exhibited a decrease in the frequencies of T cells (Figure 1) including both CD4+ T cells (Figure 2) and CD8+ T cells (Figure 3) as well as increases in the frequency of natural killer (NK) cells (Figure 4) and neutrophils (Figure 5), all in the peripheral blood.

Nature of Mutation

Figure 6. Linkage mapping of increased neutophil frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 26 mutations (X-axis) identified in the G1 male of pedigree R0588.  Raw phenotype data are shown for single locus linkage analysis without consideration for G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome sequencing of the G1 grandsire identified 26 mutations. The phenotypic anomalies were linked by continuous variable mapping to a mutation in Fas: a T to C transition at base pair 34,327,140 (v38) on chromosome 19, or base pair 36,482 in the GenBank genomic region NC_000085 encoding Fas. The strongest association was found with a recessive model of linkage to the number of neutrophils, wherein 7 affected variant homozygotes departed phenotypically from 15 homozygous reference mice and 9 heterozygous mice with a P value of 9.307 x 10-16 (Figure 6). The mutation corresponds to residue 856 in the mRNA sequence NM_007987 within exon 9 of 9 total exons. Transcript variant 2 (NM_001146708) is not affected by the cherry mutation.

 

840 ACAGCTGAGCAGAAAGTCCAGCTGCTCCTGTGC

262 -T--A--E--Q--K--V--Q--L--L--L--C-

 

The mutated nucleotide is indicated in red. The mutation results in a valine (V) to alanine (A) substitution at position 267 (V267A) in the Fas protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.993).

Protein Prediction
Figure 7. Domain structure of Fas. The cherry mutation (V267A) is shown. The signal peptide (SP) is cleaved upon maturation of the protein. Please see the text for more details about the Fas domains. Abbreviations: SP, signal peptide; CRD, cysteine-rich domain; TM, transmembrane domain; DD, death domain; ECD, extracellular domain; ICD, intracellular domain.

Fas (CD95/APO-1) is a member of the death receptor family that includes tumor necrosis factor receptor (TNFR; see the record for PanR1), nerve growth factor receptor, and B cell antigen CD40 (see the record for walla) (1;2). The members of the death receptor family share similar protein domains including an extracellular N-terminal domain (amino acids 188-327 in mouse Fas) with three cysteine-rich domains (CRD1, CRD2, and CRD3; amino acids 44-78, 81-123, and 125-161, respectively), a single transmembrane domain (amino acids 170-187), and an intracellular tail that includes a death domain (DD; amino acids 212-306) [Figure 7; (1-3); reviewed in (4)]. Fas has a signal peptide (amino acids 1-21) that is cleaved upon maturation of the protein (2).

 

The CRD1 domain of Fas facilitates homotypic interactions between Fas monomers (5-7). Fas has a putative glycosphingolipid-binding motif (GBM) within the CRD2 and CRD3 domains that regulates clathrin-mediated internalization of Fas that is necessary for subsequent downstream Fas signaling (8). Loss of function of the GBM results in clathrin- and raft-independent internalization through an ezrin-dependent pathway (8). Mutation of Phe129 (Phe129Ala), Tyr130 (Tyr130Ala), or both (Phe129Ala/Tyr130Ala) within the GBM reduced the amount of Fas-induced cell death (8). Tyr130Ala-expressing L12.10 mouse T cells also exhibited decreased motility and increased p42/p44 MAPK activation and proliferation after stimulation with Fas ligand (FasL; see the record for riogrande) (8).

 

Figure 8. Crystal structure of the death domains of Fas and FADD in complex. The location of the cherry mutation is shown. Figure was modeled after PDB:3OQ9; (14).

An early Fas signaling event is the formation of Fas microaggregates that contain detergent-resistant Fas oligomers (9;10). Binding of FasL to Fas induces the aggregation of Fas, followed by the recruitment of FADD to Fas. Fas and FADD interact via their respective DDs. Several studies have examined the interaction of the Fas DD and the DD of FADD; however, the findings on the Fas-DD:FADD-DD interaction were conflicting. The solution structure of the human Fas DD has been solved by nuclear magnetic resonance (NMR) (PDB:1DDF; amino acids 202-319) (11). The Fas DD was comprised of six antiparallel α-helices (11). Helices 1 and 2 were located at the center, with α3 and α4 on one side, and α5 and α6 on the other; the loop connecting α4 and α5 bisected α1 and α2. The C-terminal 15 residues of Fas (amino acids 305-319) were disordered (11). Fas-DD:FADD-DD was subsequently crystalized at pH 4 [PDB:3EZQ; (12)]. At pH4, the Fas-DD:FADD-DD crystal was a tetramer of two Fas-DD:FADD-DD heterodimers (12). However, crystallization of Fas-DD:FADD-DD at pH 6.2 determined that Fas interacted with FADD in a 5:5 complex via asymmetric interactions between their respective DDs, but without alterations in the globular structure of the DD [Figure 8; PDB:3OQ9; (13;14)]. At pH 6.2, the Fas-DD:FADD-DD structure was two layers with an upper layer of five Fas DD molecules and a lower layer of five FADD DD molecules (14).  Fouque et al. propose that the low pH (pH 4) in the study by Scott et al. (12) may result in the formation of non-physiological Fas:FADD oligomers (15). It has not been confirmed if the formation of the Fas:FADD complexes observed at pH 4 are physiological [reviewed in (15)]. Wang et al. determined that three types of interactions mediated Fas-DD:FADD-DD, Fas-DD:Fas-DD, and FADD-DD:FADD-DD interactions (14). The type I and III interactions mediated the assembly of the layers, while the type II interactions mediated the interactions between the layers. The type Ia interaction surface was comprised of residues from α1 and α4 that interact with the type Ib surface of α2 and α3. The type IIa surface was formed by α4 helix residues and interacts with the type IIb surface at the α5-α6 loop and α6 helix. The type IIIa surface was comprised of α1 residues and interacts with the type IIIb surface comprised of residues from the α1-α2 and the α3-α4 loops. At pH 4, Scott et al. observed an opening in the Fas DD structure that exposed the FADD binding site and generated a Fas-Fas bridge (12). Binding of FasL to Fas induced a shift of α6 and a fusion with α5 within the DD of Fas to form a “stem”-helix in an α-α hairpin interaction with a C-helix formed from the extreme C-terminal residues (12;16). The conformational change of the Fas DD promoted Fas oligomerization as well as the recruitment of the adaptor protein FADD (12;17). Esposito et al. (13) did not observe fusion of the last two helices at a more neutral pH (pH 6.2) (12). The rearrangement of the Fas-DD exposed the hydrophobic core of the Fas-DD (13). Sequence alignment determined that helices α1–α6 of the Fas DD are highly conserved, while several species (cat, dog, frog, and zebrafish) do not contain the CT region (13). A solution structure of Fas-DD constructs that did not contain the extreme C-terminal tail (CT) region determined that the Fas-DD:FADD-DD complex could form independent of the CT (13).

 

Fas undergoes several posttranslational modifications. Fas has two putative N-linked glycosylation consensus sequences (Asn-X-Ser/Thr) in the extracellular domain (Asn43 and Asn114) (2). The intracellular tail of Fas undergoes reversible oxidation, S-nitrosylation at Cys199 and Cys304 (both sites correspond to human Fas), and S-glutathionylation of Cys295 to promote Fas partitioning into lipid rafts, formation of the death-inducing signaling complex (DISC), and Fas-associated apoptotic signaling (18;19). Fas association with lipid rafts is essential for Fas internalization and its subsequent signaling function (9;20-22). Fas association with the lipid rafts is both constitutive and can be induced. In activated T cells, Fas is mostly excluded from lipid rafts, but after T cell receptor-dependent reactivation of the T cells, Fas is rapidly distributed to the lipid rafts where it can eliminate the activated T cells through apoptosis (22). Tyr232 and Tyr291 within α1 and α5 of the DD domain, respectively, can be phosphorylated (23). The Src kinases Fyn and Lyn are recruited, via their SH2 domains, to Fas upon Fas tyrosine phosphorylation to subsequently promote cell death (24;25). Tyr291 is within a conserved YXXL motif similar to an immunoreceptor tyrosine-based inhibitory motif (ITIM), a motif that recruits and activates inhibitory phosphatases (26). Tyr291 phosphorylation recruits Src homology domain 2 (SH2)-containing tyrosine phosphatase-1 (SHP-1) (27). Tyr291 is also in a putative consensus sequence for AP-2 binding (28), which assists in Fas internalization (29). Mutation of Tyr291 to a phenylalanine (Tyr291Phe), inhibited Fas internalization and, subsequently, induction of apoptosis; non-apoptotic responses were not affected (29). Cys194 in mouse Fas (Cys199 in human) has also been shown to be palmitoylated, which promotes the redistribution of Fas to detergent-resistant membranes (DRMs) and internalization of the receptor through association with the ezrin and actin cytoskeleton (10;30). Palmitoylation of Fas regulates the formation of high molecular weight DISCs (hiDISCs) found both inside and outside of DRMs (10). The formation of hiDISCs is the first step in Fas-related signaling. Mutation of Cys194 (Cys194Val) resulted in reduced cell death in L12.10 mouse T cells when stimulated with FasL compared to cells expressing wild-type Fas (30).

 

Human FAS has three mRNA variants (termed FasTMDel, FasDel2, and FasDel3) that are derived from alternative splicing and that encode soluble Fas variants (1;2;31). The soluble forms of Fas are inhibitory towards the membrane-bound Fas due to competitive binding to FasL (31). FasTMDel is the largest variant and has a 63-bp deletion (base pairs 700-762) in the cDNA that encodes a Fas protein that lacks the last five amino acids of the extracellular domain and all but one of the amino acids of the transmembrane domain (1). FasDel2 has a 247-bp deletion between positions 391 and 637 that results in a frame-shift and coding of a premature stop codon at amino acid 753; FasDel2 would code an 87 amino acid mature protein with a novel 38 amino acid C-terminus (1). FasDel3 has similar deletions as both FasTMDel and FasDel2, which results in a frame-shift and coding of a premature stop codon at 764 (1). FasDel3 encodes a 70 amino acid protein with a novel 21 amino acid C-terminus.

 

The cherry mutation (Val267Ala) is within the Fas DD.

Expression/Localization

Fas is ubiquitously expressed in both mouse and human with highest expression in the liver, heart, kidney, pancreas, brain, thymus, lung, lymphoid tissues, activated mature T and B cells, macrophages, and neutrophils [(32;33); reviewed in (4)].

 

Fas expression can be induced by ER stress-induced changes in calcium levels (34). Changes in calcium levels during ER stress results in activation of the calcium/calmodulin-dependent protein kinase IIγ (CaMKIIγ) and JNK that subsequently regulate Fas expression (34). Expression of Fas in plasmacytoid dendritic cells (pDCs) is inducible by LPS and CpG (35). In bone marrow-derived DCs, Fas expression is induced by LPS or type I interferons (35).

 

SAF RNA is transcribed on the opposite strand of intron 1 of FAS; the entire SAF gene originated from intron 1 and is an intronless gene (36). The SAF gene is conserved only among primates and is not expressed in rodents (36). SAF is expressed in heart, placenta, liver, muscle, kidney, and pancreas (36). The largest open reading frame of SAF is 120 bp, suggesting that SAF is not a protein-coding gene (36). Jurkat cells transfected with human SAF were resistant to Fas-mediated, but not TNFα-mediated, apoptosis. The levels of the FAS mRNA variants that encode the soluble forms of Fas were increased in the SAF-transfected cells; the mRNA encoding the membrane form of Fas was not affected. SAF may regulate FAS pre-mRNA splicing by forming a dsRNA duplex that either favors or disfavors the production soluble FAS (36).

Background
Figure 9. FasL/Fas receptor-associated signaling induces apoptosis. In the extrinsic apoptosis pathway (left), activated caspase-8 directly activates downstream effector caspases such as caspase-3, -6, and -7.  FasL/Fas-mediated apoptosis can also occur through the intrinsic apoptosis pathway. In the intrinsic pathway (right), caspase-8 mediates the cleavage of the pro-apoptotic Bcl-2 family member Bid to tBid and tBid translocates to the outer mitochondrial membrane (OMM) to activate Bcl-2 family members Bak and Bax. Bak oligomerizes, forming pores in the OMM that allow for the release of pro-apoptotic proteins such as cytochrome c and SMAC/DIABLO from the intermembrane space to the cytoplasm. Binding of cytochrome c and cytosolic ATP to apoptosis promoting factor-1 (Apaf-1) results in the formation of the apoptosome, a complex of cytochrome c, Apaf-1, and procaspase-9. The apoptosome activates caspase-9 which will then cleave caspase-3 and caspase-7.

Fas-associated signaling regulates apoptosis and maintains lymphocyte homeostasis [reviewed in (4)]. After FasL binding to Fas, FADD is recruited to Fas, which recruits initiator caspases 8 and 10 to form the DISC. Downstream signaling pathways are subsequently activated (Figure 9). Please see the record riogrande for a detailed description of Fas/FasL associated signaling.

 

Several Fas mutant mouse models have been characterized. Spontaneous mutant (Faslpr, MGI:1856334 and Faslpr-cg, MGI:1856335) and knockout (Fastm1Dlo, MGI:3045400; Fastm1Dlo, MGI:3045400; Fastm1Osa, MGI:1861923) mice exhibit a systemic lupus erythematosus (SLE)-like phenotype (37-43) including increased levels of serum IgM and IgG, increased production of autoantibodies, and progressive enlargement of the lymph nodes and spleen (37-39;44;45). Faslpr mice exhibited accumulation of immature double negative (DN; CD4CD8-CD3+B220+) T cells in the lymph node and spleen, and excessive T helper function (37;40;44-47). The severity of the SLE-like phenotype is dependent on the genetic background of the mice; mice on the MRL and C3H genetic backgrounds exhibited more severe symptoms of the disease compared to those on the C57BL/6 genetic background (48). Lpr mice on the MRL genetic background exhibited systemic vasculitis, arthritis, glomerulonephritis, and death (often as high as 50%) from renal failure by 6 months (37;45;47;49). Lpr mice on the C3H genetic background exhibited degeneration of the stria vascularis and elevated auditory brainstem response by 6 months following long-term systemic autoimmune disease; degeneration of the auditory hair cells was not observed (41;50). The mechanism(s) that causes the inner ear pathology have not been determined. On the C57BL/6 background (C57BL/6.Lpr), the Lpr mice exhibited reduced lymphoproliferation, later onset of autoantibody production, and less renal defects than the MRL.Lpr mice indicating that the amount and types of auto-antibodies differs among different genetic backgrounds (44;47).

 

Although wild-type mice exhibit thymic involution associated with immune system senescence with age (51), Fas-/- mice exhibited an intact thymus (52). Fas-/- mice also exhibited progressive liver hyperplasia, enlargement of hepatocyte nuclei, lymphocytosis, and lymphocytic infiltration in the lungs and liver (32;53).

 

Conditional Fas knockout mice have also been generated (Fastm1.1Cgn, MGI:3690544 and Fastm1Ach, MGI:3589104). Specific ablation of Fas in T cells (T-Fas), B cells (B-Fas), T and B cells revealed that the lymphoproliferative phenotype observed in the Lpr and Fas-/- mice requires Fas deletion in both lymphoid and nonlymphoid tissues. T cell-specific knockout of Fas resulted in progressive lymphopenia, splenomegaly, lymphadenopathy, and apoptosis of peripheral lymphocytes as well as a fatal chronic inflammatory lung disease (48). Very few DN T cells were observed in the lymph nodes of the T-Fas mice and by 7 months of age, 91% of the T cells in the spleens of the T-Fas mice were activated/memory cells (48). The B-Fas mice exhibited enlargement of the lymph nodes and spleen, but no changes in DN expansion. T or B cell-specific deletion of Fas resulted in a 3- to 8-fold increase anti-single strand DNA antibodies (48). Antigen presenting cell (APC)-specific deletion of Fas (Fastm1Ach, MGI:3589104) resulted in increased levels of IgG and IgM as well as systemic autoimmunity including hyperimmunoglobulinemia, splenomegaly, and high titers of ANA (35). The APC-Fas mice exhibited mislocalization of DCs throughout the periarteriolar lymphoid sheath. Stranges et al. produced APC (DC or B cell)- or T cell-specific knockout mice. B-Fas mice also exhibited splenomegaly due to lymphoproliferation of polyclonal B and T cells as well as systemic autoimmunity (35;48). Mice with active T cell-specific deletion of Fas exhibited high titers of ANA compered to littermates as well as a slight increase in splenic cellularity. In contrast to Hao et al. (48), Stranges et al. did not observe decreased viability or internal organ damage in T-Fas mice. The mechanism leading to the differences in the findings between the studies was not determined.

 

Mutations in FAS are linked to autoimmune lymphoproliferative syndrome, type Ia (ALPS; alternatively, Canale-Smith syndrome; OMIM: #601859) (54-56). In ALPS, patients exhibit nonmalignant lymphadenopathy with splenomegaly (57). ALPS is an autosomal dominant disorder of Fas/FasL-induced apoptosis, resulting in the accumulation of autoreactive lymphocytes and the production of autoantibodies (58). Although ALPS patients may exhibit normal immune function, up to 40% double-negative T cells can be detected by flow cytometry (57). ALPS also often includes Coombs-positive hemolytic anemia, chronic immune thrombocytopenic purpura, and neutropenia (57). ALPS patients have increased incidences of Hodgkin and non-Hodgkin lymphoma (59;60).  Mutations in FAS are also associated with increased risk for solid tumors (61).

Putative Mechanism

Characterization of the cherry mice determined that, similar to the Fas mutant mouse models described above, the cherry mice exhibit lymphopenia. Similarity between cherry and Fas-deficient phenotypes is consistent with a strongly hypomorphic or null effect of the Val265Ala mutation in cherry.

Primers PCR Primer
cherry(F):5'- TCTCACCTAGCGCAGATGTGAACC -3'
cherry(R):5'- AGAACACACCAGGAGTTGCCAATG -3'

Sequencing Primer
cherry_seq(F):5'- TGAACCCGGCTTCTGTAAG -3'
cherry_seq(R):5'- ACTGAGGTAGTTTTCACTCCAGAC -3'
Genotyping

Cherry genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Cherry(F): 5’- TCTCACCTAGCGCAGATGTGAACC-3’

Cherry(R): 5’- AGAACACACCAGGAGTTGCCAATG-3’

 

Sequencing Primer

Cherry_seq(F): 5’- TGAACCCGGCTTCTGTAAG-3’
 

Cherry_seq(R): 5’- ACTGAGGTAGTTTTCACTCCAGAC-3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 523 nucleotides (from Genbank genomic region NC_000085 for linear DNA sequence of Fas) is amplified:

 

36249         tc tcacctagcg cagatgtgaa cccggcttct gtaagggggt ttctcctaga    

36301 cagacatttt cagaaactat tttctgtttt tcagatctta gcttgagtaa atacatcccg    

36361 agaattgctg aagacatgac aatccaggaa gctaaaaaat ttgctcgaga aaataacatc    

36421 aaggagggca agatagatga gatcatgcat gacagcatcc aagacacagc tgagcagaaa    

36481 gtccagctgc tcctgtgctg gtaccaatct catgggaaga gtgatgcata tcaagattta    

36541 atcaagggtc tcaaaaaagc cgaatgtcgc agaaccttag ataaatttca ggacatggtc    

36601 cagaaggacc ttggaaaatc aaccccagac actggaaatg aaaatgaagg acaatgtctg    

36661 gagtgaaaac tacctcagtt ccagccatga agagaggaga gagcctgcca cccatgatgg    

36721 aaacaaaatg aatgccaact gtattgacat tggcaactcc tggtgtgttc t    

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text.

References
  23. Gradl, G., Grandison, P., Lindridge, E., Wang, Y., Watson, J., and Rudert, F. (1996) The CD95 (Fas/APO-1) Receptor is Phosphorylated in Vitro and in Vivo and Constitutively Associates with several Cellular Proteins. Apoptosis. 1, 131-140.
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler
List |< first << previous [record 66 of 511] next >> last >|