Phenotypic Mutation 'citron' (pdf version)
List |< first << previous [record 72 of 511] next >> last >|
Allelecitron
Mutation Type splice donor site (4 bp from exon)
Chromosome8
Coordinate71,686,976 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Jak3
Gene Name Janus kinase 3
Synonym(s) fae; wil
Chromosomal Location 71,676,296-71,690,575 bp (+)
MGI Phenotype Homozygous null mutants exhibit a severe B cell development block. Mutants have small thymi, and in response to mitogenic signals their peripheral T cells fail to proliferate and secrete only small amounts of IL-2. Point mutation homozygotes develop autoimmune inflammatory bowel disease.
Accession Number

NCBI RefSeq: NM_010589; NM_001190830; MGI:99928

Mapped Yes 
Amino Acid Change
Institutional SourceBeutler Lab
Gene Model not available
SMART Domains Protein: ENSMUSP00000060073
Gene: ENSMUSG00000031805

DomainStartEndE-ValueType
B41 20 254 2.2e-42 SMART
SH2 370 460 5.57e-8 SMART
low complexity region 488 503 N/A INTRINSIC
STYKc 517 773 3.58e-12 SMART
TyrKc 818 1091 4.59e-105 SMART
Predicted Effect
Phenotypic Category cellular phenotype, hematopoietic system, immune system, increase in B cells, increase in B:T cells, increase in IgD+ B cells, increase in IgM+ B cells
Penetrance  
Alleles Listed at MGI

All mutations/alleles(23) : Chemically induced (ENU)(3) Gene trapped(14) Spontaneous(1) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Jak3 APN 8 71681697 splice donor site probably benign 0.00
IGL00720:Jak3 APN 8 71684037 missense probably damaging 1.00
IGL00966:Jak3 APN 8 71679012 missense probably benign 0.36
IGL01147:Jak3 APN 8 71683403 missense probably benign
IGL01308:Jak3 APN 8 71685166 missense probably damaging 1.00
IGL01328:Jak3 APN 8 71679620 missense probably damaging 1.00
IGL01386:Jak3 APN 8 71684289 missense probably damaging 1.00
IGL01515:Jak3 APN 8 71680562 splice donor site probably null 0.00
IGL01870:Jak3 APN 8 71680790 missense probably damaging 1.00
IGL02132:Jak3 APN 8 71678480 missense probably damaging 0.99
IGL02413:Jak3 APN 8 71686119 missense probably damaging 0.99
IGL02752:Jak3 APN 8 71682951 missense probably benign 0.45
IGL03089:Jak3 APN 8 71686083 missense probably benign 0.13
IGL03177:Jak3 APN 8 71682370 missense probably damaging 1.00
mount_tai UTSW 8 71683377 missense probably damaging 1.00
thistle UTSW 8 71685383 critical splice acceptor site probably null
thistle2 UTSW 8 71685545 missense probably damaging 1.00
R0013:Jak3 UTSW 8 71684327 missense probably damaging 0.98
R0496:Jak3 UTSW 8 71682397 missense probably damaging 1.00
R0522:Jak3 UTSW 8 71682274 splice acceptor site probably benign
R0538:Jak3 UTSW 8 71685482 missense probably benign
R0744:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0833:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R0836:Jak3 UTSW 8 71683978 missense probably damaging 1.00
R1183:Jak3 UTSW 8 71684550 missense probably damaging 1.00
R1420:Jak3 UTSW 8 71681538 missense possibly damaging 0.84
R1625:Jak3 UTSW 8 71682886 splice acceptor site probably benign
R1793:Jak3 UTSW 8 71685946 splice acceptor site probably benign
R1967:Jak3 UTSW 8 71681535 missense probably damaging 1.00
R1983:Jak3 UTSW 8 71678375 missense probably damaging 0.97
R1983:Jak3 UTSW 8 71688136 missense probably benign
R2058:Jak3 UTSW 8 71685383 critical splice acceptor site probably null
R2060:Jak3 UTSW 8 71680714 nonsense probably null
R2060:Jak3 UTSW 8 71683415 nonsense probably null
R3705:Jak3 UTSW 8 71681522 missense probably damaging 1.00
R3734:Jak3 UTSW 8 71676581 nonsense probably null
R4032:Jak3 UTSW 8 71680404 missense noncoding transcript
R4231:Jak3 UTSW 8 71685545 missense probably damaging 1.00
R4596:Jak3 UTSW 8 71684631 missense probably damaging 0.99
R4844:Jak3 UTSW 8 71681655 missense possibly damaging 0.62
R4897:Jak3 UTSW 8 71685404 missense probably damaging 1.00
R5038:Jak3 UTSW 8 71686058 missense probably damaging 0.98
R5083:Jak3 UTSW 8 71680097 missense noncoding transcript
R5469:Jak3 UTSW 8 71678773 missense probably benign
R5538:Jak3 UTSW 8 71678773 missense probably benign
R5718:Jak3 UTSW 8 71684354 missense probably damaging 1.00
R5800:Jak3 UTSW 8 71678700 missense probably damaging 1.00
R5880:Jak3 UTSW 8 71678364 missense noncoding transcript
R5909:Jak3 UTSW 8 71684231 missense possibly damaging 0.63
R5959:Jak3 UTSW 8 71682071 missense probably damaging 1.00
X0018:Jak3 UTSW 8 71685741 splice acceptor site probably benign
Z1088:Jak3 UTSW 8 71680864 nonsense probably null
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
MMRRC Submission 038161-MU
Last Updated 05/13/2016 3:09 PM by Peter Jurek
Record Created 06/14/2014 10:20 PM by Ming Zeng
Record Posted 02/11/2015
Phenotypic Description

Figure 1. Citron mice exhibit an increased B:T cell ratio in the periphery. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Citron mice exhibit increased frequencies of peripheral B cells. Flow cytometric analysis of peripheral blood was utilized to determine B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Citron mice exhibit increased frequencies of peripheral IgM+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgM+ B cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Citron mice exhibit an increased percentage of peripheral IgD+ B cells. Flow cytometric analysis of peripheral blood was utilized to determine IgD+ B cell percentage. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The citron phenotype was identified among N-Nitroso-N-ethylurea (ENU)-mutagenized G3 mice of the pedigree R0531, some of which showed an increase in the B:T cell ratio (Figure 1) due to an increased frequency of B cells (Figure 2) as well as an increased frequency of IgM+ B cells (Figure 3) and a higher percentage of IgD+ B cells (Figure 4), all in the peripheral blood.   

Nature of Mutation

Figure 5. Linkage mapping of the reduced B cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 74 mutations (X-axis) identified in the G1 male of pedigree R0531.  Normalized phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 74 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Jak3:  a C to T transition at base pair 71,686,976 (v38) on chromosome 8, or base pair 10,594 in the GenBank genomic region NC_000074 encoding Jak3. The strongest association was found with a recessive model of linkage to the normalized B cell frequency, wherein three variant homozygotes departed phenotypically from six homozygous reference mice and 11 heterozygous mice with a P value of 2.244 x 10-7 (Figure 5).  The mutation is located within the donor splice site of intron 22, four nucleotides from the previous exon. Two Jak3 protein-coding transcripts are displayed on Ensembl; both transcripts encode the same protein. The effect of the mutation at the cDNA and protein level is unknown.  One possibility, shown below, is that aberrant splicing would cause skipping of the 118 base pair exon 22 (out of 25 total exons; exon 22 encodes amino acids 990-1028) and a frame-shift that results in coding of two aberrant amino acids followed by a premature stop codon in exon 23.  

 

        <--exon 21      <--exon 22 intron 22-->     exon 23-->

9733 ……CCCATCTTTTG ………AGCCCATCCGCT gtgcgtcgcctgc……… GAGTTCCTGA 10866
986  ……-P--I--F--W ………-S--P--S--A-                  --S--S--*  991

         correct        deleted                      aberrant

 

Genomic numbering corresponds to NC_000074. The donor splice site of intron 22, which is destroyed by the mutation, is indicated in blue; the mutated nucleotide is indicated in red.

Protein Prediction
Figure 6. Domain structure of JAK3. The citron mutation is indicated. Abbreviations: B41, 4.1, ezrin, radixin, moesin (FERM) homology domain; SH2, Src Homology 2-like. This image is interactive; click to view other Jak3 mutations.

Jak3 encodes Janus kinase 3 (JAK3). JAK3 has seven different highly conserved JAK homology (JH) regions (JH1-JH7) [Figure 6; reviewed in (1)]. The JH1 region is the kinase domain (amino acids 818-1091), the JH2 domain corresponds to the pseudokinase domain (amino acids 517-773), the JH3 and JH4 regions comprise an Src Homology 2 (SH2)-like domain (amino acids 370-460), and the JH6 and JH7 regions consist of a 4.1, ezrin, radixin, moesin (FERM) homology domain (alternatively, B41 domain; amino acids 20-254). The citron mutation is predicted to result in deletion of exon 22 which encodes amino acids 990-1023 within the JAK3 kinase domain, a frame-shift, and coding of a premature stop codon within the JAK3 kinase domain. Expression and localization of JAK3­citron have not been examined.

 

Please see the record mount_tai for more information about Jak3.

Putative Mechanism

JAK3 binding is restricted to hematopoietic-specific cytokine receptors that have a γc receptor subunit (i.e., the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors) [reviewed in (1)]. The γc receptor-associated cytokines have known functions. For example, IL-7 is necessary for T and B cell development, IL-2 functions in peripheral T cell homeostasis and antigen-driven T-cell expansion, IL-15 functions in natural killer (NK) cell differentiation, IL-4 functions in B-cell maturation and isotype switching (2). JAK3 mutations result in defective γc receptor-associated signaling and subsequent defects in lymphocyte development (2;3). Mutations in JAK3 are linked to autosomal recessive T- and NK-cell negative/B-cell positive type of severe combined immunodeficiency [TB+NK- SCID; OMIM: #600802; (4-6); reviewed in (2)]. Patients with TB+NK- SCID do not have T or NK cells, but have normal to elevated numbers of immature nonfunctional B lymphocytes (5;6). Patients with SCID have persistent, recurring infections due to loss of T cell-associated immunity.  Jak3 knockout (Jak3-/-) mice have reduced numbers of T, B, γδ T, and NK cells (7-11). B cell maturation in the Jak3-/- mice is blocked at the pre-B stage, leading to a reduced frequency of IgM+ B cells (10). In contrast to Jak3-/- mice, citron mice exhibit increased frequencies of IgM+ B cells. Similar to patients with TB+NK- SCID, the citron mice have increased frequencies of peripheral B cells, including the IgM+ and IgD+ B cells; however the frequency of peripheral T and NK cells were comparable between the citron and wild-type mice, indicating that JAK3­citron may retain some function.

Primers PCR Primer
citron(F):5'- GCCATACTTCACATTGACGACTCCC -3'
citron(R):5'- AAAGTATTCCCAGTCAGGCACCGC -3'

Sequencing Primer
citron_seq(F):5'- AGGCCACTGTTTCACACC -3'
citron_seq(R):5'- ATCATGCTCAGGAACTCCTGTG -3'
References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsMing Zeng, Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler
List |< first << previous [record 72 of 511] next >> last >|